Incidental Mutation 'R6959:Arhgef12'
ID541657
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6959 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43015953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 292 (T292A)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect probably benign
Transcript: ENSMUST00000072767
AA Change: T292A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: T292A

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165665
AA Change: T292A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: T292A

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213566
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42992536 missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 43027271 missense probably damaging 1.00
R8074:Arhgef12 UTSW 9 42971103 nonsense probably null
RF020:Arhgef12 UTSW 9 42989989 missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42971072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGAAGAGTGTGCAGAACTTC -3'
(R):5'- TTGGTAGCCAGCCCTTAAC -3'

Sequencing Primer
(F):5'- CACATAGCTTAAGAAAGGGA -3'
(R):5'- TCCATGTAGAATGTATGGGCAC -3'
Posted On2018-11-28