Mutagenetix > Incidental Mutations

Incidental Mutation 'R6959:Usp28'

541658

Institutional Source

Beutler Lab

Gene Symbol

Usp28

Ensembl Gene

ENSMUSG00000032267

Gene Name

ubiquitin specific peptidase 28

Synonyms

9830148O20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6959 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48985375-49042517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49001542 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 31 (L31H)

Ref Sequence

ENSEMBL: ENSMUSP00000150005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215788]

AlphaFold

Q5I043

Predicted Effect

probably damaging
Transcript: ENSMUST00000047349
AA Change: L57H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: L57H

Domain	Start	End	E-Value	Type
UIM	97	116	3.1e-3	SMART
Pfam:UCH	161	652	5.4e-52	PFAM
Pfam:UCH_1	162	626	2e-11	PFAM
low complexity region	695	705	N/A	INTRINSIC
low complexity region	713	730	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000213874
AA Change: L57H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215788
AA Change: L31H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

94% (61/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	G	A	11: 70,616,659	G177R	probably damaging	Het
4932438A13Rik	T	G	3: 36,967,189	V2154G	probably damaging	Het
Arhgef12	T	C	9: 43,015,953	T292A	probably benign	Het
Atp11a	T	A	8: 12,820,467	D173E	probably damaging	Het
Btnl2	G	A	17: 34,363,359	V300M	possibly damaging	Het
Calcrl	A	T	2: 84,370,084	N117K	possibly damaging	Het
Ccl22	A	T	8: 94,746,900		probably null	Het
Cd200r1	T	A	16: 44,790,176	S216T	probably damaging	Het
Cdk5rap2	G	A	4: 70,360,669		probably null	Het
Cfap157	A	G	2: 32,784,248	I47T	probably damaging	Het
Chodl	G	A	16: 78,946,684	V220I	probably damaging	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Cstf3	A	G	2: 104,649,462	T225A	probably benign	Het
Duoxa1	T	C	2: 122,303,837	S267G	probably damaging	Het
Epb41l1	G	A	2: 156,499,587	S164N	probably benign	Het
Fam126a	T	C	5: 23,991,756	I45V	possibly damaging	Het
Fat3	T	C	9: 15,996,885	D2607G	possibly damaging	Het
Galnt5	A	G	2: 57,999,219	D277G	probably benign	Het
Galnt6	A	G	15: 100,714,125	I212T	probably damaging	Het
Gatsl2	T	C	5: 134,135,213	S83P	probably damaging	Het
Gm45861	T	C	8: 27,548,185		probably null	Het
Gm5478	T	C	15: 101,645,448	D243G	probably damaging	Het
Gm6657	A	G	12: 78,202,296	K139E	probably damaging	Het
Gm7682	T	A	5: 94,447,032	N250K	possibly damaging	Het
Gse1	A	G	8: 120,570,971		probably benign	Het
Hspg2	A	T	4: 137,519,289	Q1096L	probably benign	Het
Idh3b	A	G	2: 130,281,527	V181A	probably damaging	Het
Igf2bp3	T	C	6: 49,117,148		probably null	Het
Ikzf2	A	G	1: 69,538,770	*382Q	probably null	Het
Impg2	A	C	16: 56,268,330	H1073P	probably benign	Het
Incenp	T	C	19: 9,876,770	E639G	unknown	Het
Kcne4	A	G	1: 78,817,886	M84V	probably benign	Het
Ktn1	T	A	14: 47,720,256	F1004I	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Malrd1	A	G	2: 16,218,009	I2040V	probably damaging	Het
Mau2	T	C	8: 70,033,228	D110G	probably damaging	Het
Mei1	T	C	15: 82,124,875	V1237A	probably benign	Het
Mfsd11	T	G	11: 116,861,669		probably null	Het
Ncapd2	A	G	6: 125,168,920	F1293L	probably benign	Het
Nf1	A	G	11: 79,549,468	T280A	probably damaging	Het
Obscn	G	T	11: 59,037,585	A6085E	probably damaging	Het
Olfr623	T	A	7: 103,660,843	I136F	probably damaging	Het
Pdzd2	C	T	15: 12,375,907	A1381T	probably benign	Het
Ralgapa2	A	G	2: 146,342,701	V1462A	probably damaging	Het
Rbx1	T	A	15: 81,470,962	C56*	probably null	Het
Reln	A	G	5: 21,976,564	S1774P	probably damaging	Het
Ros1	T	A	10: 52,163,994	E300D	probably damaging	Het
Sarnp	T	C	10: 128,848,268	V111A	possibly damaging	Het
Scube1	G	T	15: 83,629,435	Q345K	probably benign	Het
Slc18b1	A	G	10: 23,826,044		probably null	Het
Slc37a2	T	A	9: 37,241,334	T64S	probably benign	Het
Slit2	A	G	5: 48,238,385	D710G	possibly damaging	Het
Srp72	T	A	5: 76,994,223	Y375N	possibly damaging	Het
Tmco4	T	A	4: 139,010,499	V135D	probably damaging	Het
Trim62	A	G	4: 128,909,162	D335G	probably damaging	Het
Tsfm	T	C	10: 127,022,909	M196V	probably benign	Het
Tspan10	T	A	11: 120,444,696	C211S	probably damaging	Het
Ttc21b	A	T	2: 66,231,312	M498K	probably benign	Het
Ttc6	A	T	12: 57,658,142		probably null	Het
Ttll1	G	T	15: 83,502,196	Y69*	probably null	Het
Vmn2r86	A	G	10: 130,446,531	S739P	probably damaging	Het
Wdr64	T	A	1: 175,705,989	F64I	probably damaging	Het
Ywhaq	A	G	12: 21,396,280		probably null	Het
Zfr	T	C	15: 12,150,323	S459P	probably damaging	Het

Other mutations in Usp28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Usp28	APN	9	49028163	missense	probably benign	0.01
IGL01105:Usp28	APN	9	49010250	missense	probably damaging	1.00
IGL01124:Usp28	APN	9	49037213	missense	probably damaging	1.00
IGL01304:Usp28	APN	9	49026819	missense	probably damaging	0.99
IGL01527:Usp28	APN	9	49025873	missense	probably benign	0.02
IGL01859:Usp28	APN	9	49024021	nonsense	probably null
IGL01860:Usp28	APN	9	49032243	nonsense	probably null
IGL02047:Usp28	APN	9	49035641	missense	probably damaging	0.99
IGL02188:Usp28	APN	9	49024009	missense	probably benign	0.00
IGL02267:Usp28	APN	9	49023965	missense	probably damaging	1.00
IGL02472:Usp28	APN	9	49037769	missense	possibly damaging	0.95
IGL02675:Usp28	APN	9	49039091	missense	possibly damaging	0.81
IGL02982:Usp28	APN	9	49018439	missense	probably benign	0.00
IGL03105:Usp28	APN	9	49039055	missense	probably damaging	0.99
R0100:Usp28	UTSW	9	49035932	missense	probably damaging	1.00
R0114:Usp28	UTSW	9	49039023	missense	probably benign	0.00
R0196:Usp28	UTSW	9	49028278	missense	probably damaging	0.96
R0206:Usp28	UTSW	9	49028269	missense	probably damaging	1.00
R0349:Usp28	UTSW	9	49010281	nonsense	probably null
R0379:Usp28	UTSW	9	49024067	missense	possibly damaging	0.58
R0454:Usp28	UTSW	9	49039101	missense	possibly damaging	0.94
R0479:Usp28	UTSW	9	49037213	missense	probably damaging	1.00
R0540:Usp28	UTSW	9	49024060	missense	probably benign
R0726:Usp28	UTSW	9	49003869	missense	probably damaging	1.00
R0835:Usp28	UTSW	9	49001524	missense	probably damaging	1.00
R0928:Usp28	UTSW	9	49030891	missense	possibly damaging	0.60
R1271:Usp28	UTSW	9	49035961	critical splice donor site	probably null
R1534:Usp28	UTSW	9	48985506	missense	possibly damaging	0.92
R1539:Usp28	UTSW	9	49037796	missense	probably benign	0.07
R1687:Usp28	UTSW	9	49024017	missense	probably benign	0.00
R1867:Usp28	UTSW	9	49009194	missense	probably benign	0.00
R1868:Usp28	UTSW	9	49016707	missense	probably damaging	1.00
R1884:Usp28	UTSW	9	49035947	missense	probably damaging	1.00
R2029:Usp28	UTSW	9	48985503	missense	probably benign	0.22
R2046:Usp28	UTSW	9	49039075	missense	probably damaging	1.00
R2379:Usp28	UTSW	9	49003095	missense	probably null	0.94
R2404:Usp28	UTSW	9	49037258	critical splice donor site	probably null
R3196:Usp28	UTSW	9	49025825	missense	probably benign	0.03
R3831:Usp28	UTSW	9	49035638	missense	probably benign	0.00
R3922:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3924:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3926:Usp28	UTSW	9	49030923	critical splice donor site	probably null
R3943:Usp28	UTSW	9	49000366	missense	probably benign	0.12
R4834:Usp28	UTSW	9	49001536	missense	probably damaging	1.00
R5041:Usp28	UTSW	9	49037773	missense	probably benign
R5186:Usp28	UTSW	9	49010250	missense	probably damaging	1.00
R5308:Usp28	UTSW	9	49037201	missense	probably damaging	1.00
R5870:Usp28	UTSW	9	49025985	nonsense	probably null
R6838:Usp28	UTSW	9	49000430	critical splice donor site	probably null
R7058:Usp28	UTSW	9	49039156	missense	probably damaging	1.00
R7348:Usp28	UTSW	9	49030877	missense	probably benign	0.19
R7766:Usp28	UTSW	9	49035883	missense	probably damaging	1.00
R7814:Usp28	UTSW	9	49003918	missense	probably benign	0.01
R7828:Usp28	UTSW	9	49003902	missense	possibly damaging	0.95
R8167:Usp28	UTSW	9	49037848	missense	probably damaging	0.99
R8226:Usp28	UTSW	9	49015397	splice site	probably null
R8273:Usp28	UTSW	9	49026882	missense	probably damaging	1.00
R8972:Usp28	UTSW	9	49037824	missense	probably null	0.83
R8998:Usp28	UTSW	9	49037839	missense	probably benign
R9312:Usp28	UTSW	9	49015139	nonsense	probably null
Z1176:Usp28	UTSW	9	49035925	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTCTTCGTATCACCTGGCTTG -3'
(R):5'- CTCAGTGACCCCTCAGAAAG -3'

Sequencing Primer
(F):5'- TCTGCCTCAGACCTATGATTGGG -3'
(R):5'- CTCAGAAAGGGTTGATGTGATAAATG -3'

Posted On

2018-11-28