Incidental Mutation 'R6959:Ros1'
ID 541659
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene Name Ros1 proto-oncogene
Synonyms Ros-1, c-ros
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R6959 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 52045721-52195244 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52163994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 300 (E300D)
Ref Sequence ENSEMBL: ENSMUSP00000151720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
AlphaFold Q78DX7
Predicted Effect probably benign
Transcript: ENSMUST00000020045
AA Change: E300D

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: E300D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117992
AA Change: E300D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: E300D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175892
AA Change: E291D

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135235
Gene: ENSMUSG00000019893
AA Change: E291D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 100 178 1.05e-4 SMART
FN3 196 273 7.45e-10 SMART
Blast:LY 360 400 1e-20 BLAST
Blast:LY 449 486 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177378
AA Change: E300D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: E300D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218452
AA Change: E300D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219173
AA Change: E300D

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219692
AA Change: E291D

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
boss UTSW 10 52090995 nonsense probably null
Chuckwagon UTSW 10 52118203 missense probably damaging 1.00
R1005_Ros1_648 UTSW 10 52128405 splice site probably benign
R1220_Ros1_012 UTSW 10 52098870 missense probably damaging 0.97
R3423_Ros1_122 UTSW 10 52128416 splice site probably null
trail UTSW 10 52161895 nonsense probably null
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 splice site probably null
R3424:Ros1 UTSW 10 52128416 splice site probably null
R3425:Ros1 UTSW 10 52128416 splice site probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
R7355:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R7385:Ros1 UTSW 10 52155126 missense probably benign 0.00
R7460:Ros1 UTSW 10 52118203 missense probably damaging 1.00
R7549:Ros1 UTSW 10 52145834 missense probably damaging 0.96
R7573:Ros1 UTSW 10 52169976 missense probably benign 0.03
R7650:Ros1 UTSW 10 52046209 missense probably benign 0.00
R7667:Ros1 UTSW 10 52163971 missense probably damaging 1.00
R7696:Ros1 UTSW 10 52142283 missense probably damaging 1.00
R7785:Ros1 UTSW 10 52162848 missense probably damaging 1.00
R7814:Ros1 UTSW 10 52096137 missense probably benign 0.28
R7830:Ros1 UTSW 10 52154934 missense probably damaging 0.99
R7832:Ros1 UTSW 10 52144861 missense probably damaging 0.99
R7854:Ros1 UTSW 10 52128467 missense probably damaging 1.00
R7912:Ros1 UTSW 10 52168695 missense probably damaging 1.00
R7972:Ros1 UTSW 10 52154830 nonsense probably null
R7993:Ros1 UTSW 10 52123347 missense probably benign 0.34
R8036:Ros1 UTSW 10 52165343 missense probably benign
R8137:Ros1 UTSW 10 52125837 missense possibly damaging 0.87
R8169:Ros1 UTSW 10 52064672 critical splice donor site probably null
R8199:Ros1 UTSW 10 52101717 nonsense probably null
R8293:Ros1 UTSW 10 52087918 missense probably damaging 1.00
R8368:Ros1 UTSW 10 52064737 missense probably damaging 1.00
R8406:Ros1 UTSW 10 52101845 missense possibly damaging 0.56
R8471:Ros1 UTSW 10 52120982 missense probably benign 0.00
R8498:Ros1 UTSW 10 52178951 missense probably damaging 0.99
R8532:Ros1 UTSW 10 52098756 missense possibly damaging 0.92
R8678:Ros1 UTSW 10 52087902 missense probably benign
R8726:Ros1 UTSW 10 52078673 missense possibly damaging 0.46
R8789:Ros1 UTSW 10 52123232 missense probably damaging 0.99
R8799:Ros1 UTSW 10 52046047 missense probably benign 0.08
R8915:Ros1 UTSW 10 52101709 splice site probably benign
R8958:Ros1 UTSW 10 52096094 missense probably damaging 1.00
R8972:Ros1 UTSW 10 52123237 missense probably benign 0.05
R9020:Ros1 UTSW 10 52154927 missense probably benign 0.32
R9147:Ros1 UTSW 10 52050943 missense probably benign
R9154:Ros1 UTSW 10 52046205 missense possibly damaging 0.87
R9189:Ros1 UTSW 10 52143406 missense probably damaging 0.99
R9341:Ros1 UTSW 10 52096020 critical splice donor site probably null
R9343:Ros1 UTSW 10 52096020 critical splice donor site probably null
R9407:Ros1 UTSW 10 52118395 missense probably damaging 1.00
R9428:Ros1 UTSW 10 52081965 missense probably benign 0.00
RF018:Ros1 UTSW 10 52155121 missense probably benign
Z1176:Ros1 UTSW 10 52091109 missense possibly damaging 0.89
Z1177:Ros1 UTSW 10 52168671 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGCTCTGGGATCTAAGAGCAAC -3'
(R):5'- ATTTCCTACTGCCAGCCATG -3'

Sequencing Primer
(F):5'- GCTAGCCTTGAACTCAGAAATTTGCC -3'
(R):5'- AGCCATGGATTTATGAAGATTATGTC -3'
Posted On 2018-11-28