Incidental Mutation 'R0606:Usp36'
ID 54166
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
MMRRC Submission 038795-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R0606 (G1)
Quality Score 100
Status Validated
Chromosome 11
Chromosomal Location 118150477-118181070 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 118153854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect probably benign
Transcript: ENSMUST00000092382
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106296
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141647
Predicted Effect probably benign
Transcript: ENSMUST00000144153
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148998
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,572 (GRCm39) Y211H probably damaging Het
Actn1 A T 12: 80,221,421 (GRCm39) probably benign Het
Adtrp A G 13: 41,920,881 (GRCm39) F197L probably damaging Het
Ankrd11 G A 8: 123,619,571 (GRCm39) T1406I probably benign Het
Arhgap24 A T 5: 103,045,086 (GRCm39) R620W probably damaging Het
Atg13 A G 2: 91,512,418 (GRCm39) Y284H probably benign Het
Atrn A G 2: 130,748,776 (GRCm39) E99G possibly damaging Het
Cage1 A T 13: 38,200,470 (GRCm39) probably benign Het
Cblif A T 19: 11,729,658 (GRCm39) I206F possibly damaging Het
Ccr3 T A 9: 123,828,839 (GRCm39) M58K probably benign Het
Cdk18 G T 1: 132,045,355 (GRCm39) probably benign Het
Chst5 A G 8: 112,617,551 (GRCm39) V23A probably benign Het
Col4a3 T C 1: 82,650,307 (GRCm39) probably benign Het
Col4a6 A G X: 139,975,219 (GRCm39) probably benign Het
Csmd3 T C 15: 48,321,058 (GRCm39) I251V probably benign Het
Csnk1g3 G A 18: 54,050,100 (GRCm39) V115M probably damaging Het
Cst7 A T 2: 150,412,439 (GRCm39) M1L probably benign Het
Cyp4f17 A T 17: 32,746,817 (GRCm39) D373V probably damaging Het
Dclk2 G A 3: 86,813,311 (GRCm39) R212W probably damaging Het
Dhrs7b T G 11: 60,721,572 (GRCm39) probably benign Het
Dhx58 T A 11: 100,593,077 (GRCm39) H210L probably benign Het
Dnah9 T C 11: 65,732,159 (GRCm39) Y4249C probably damaging Het
Eif5b T A 1: 38,087,974 (GRCm39) L990H probably damaging Het
Faap24 T C 7: 35,094,388 (GRCm39) probably benign Het
Fryl T A 5: 73,282,077 (GRCm39) H174L probably benign Het
Gabrr1 T C 4: 33,132,696 (GRCm39) W15R probably benign Het
Gm15446 T C 5: 110,091,347 (GRCm39) V533A probably benign Het
Gm6760 T A X: 63,195,259 (GRCm39) K63* probably null Het
Gne C T 4: 44,042,244 (GRCm39) E444K possibly damaging Het
Gpr173 T A X: 151,130,036 (GRCm39) M146L possibly damaging Het
Hira C T 16: 18,753,797 (GRCm39) S547L probably benign Het
Hnf1b A G 11: 83,754,810 (GRCm39) H161R probably benign Het
Hnrnpm T A 17: 33,877,364 (GRCm39) N53I probably damaging Het
Hs3st5 A T 10: 36,708,584 (GRCm39) I40F probably benign Het
Hydin C T 8: 111,276,430 (GRCm39) probably benign Het
Ift172 A G 5: 31,411,657 (GRCm39) I1607T probably damaging Het
Igfn1 T C 1: 135,887,639 (GRCm39) Q2475R probably damaging Het
Il6st T C 13: 112,640,806 (GRCm39) S800P possibly damaging Het
Iqub G A 6: 24,501,260 (GRCm39) probably benign Het
Itgb1 A T 8: 129,448,853 (GRCm39) probably benign Het
Kctd21 G A 7: 96,996,808 (GRCm39) E94K probably benign Het
Kir3dl2 A G X: 135,354,260 (GRCm39) V233A possibly damaging Het
Klra2 A T 6: 131,197,187 (GRCm39) C271S probably damaging Het
Lacc1 A T 14: 77,267,061 (GRCm39) C401S probably damaging Het
Lmna T C 3: 88,389,885 (GRCm39) E580G probably damaging Het
Matn2 A G 15: 34,345,296 (GRCm39) Y101C probably damaging Het
Mrps16 G A 14: 20,441,457 (GRCm39) R116* probably null Het
Ndrg2 G T 14: 52,143,674 (GRCm39) R333S probably damaging Het
Nf2 A G 11: 4,732,194 (GRCm39) I507T possibly damaging Het
Nktr A G 9: 121,578,356 (GRCm39) probably benign Het
Nkx3-1 G A 14: 69,428,455 (GRCm39) probably benign Het
Npat T C 9: 53,467,781 (GRCm39) probably null Het
Nrxn1 T C 17: 90,872,801 (GRCm39) N1047S probably damaging Het
Nup210 A T 6: 91,003,911 (GRCm39) I1402N possibly damaging Het
Or5d40 G T 2: 88,015,624 (GRCm39) M134I possibly damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pdcl2 C T 5: 76,460,328 (GRCm39) S182N probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pla2g4a A G 1: 149,716,455 (GRCm39) F669L probably benign Het
Plekha8 A G 6: 54,606,805 (GRCm39) K367E probably damaging Het
Pola1 A G X: 92,531,693 (GRCm39) probably benign Het
Ppm1d C T 11: 85,236,703 (GRCm39) T494I probably benign Het
Pramel16 T A 4: 143,676,453 (GRCm39) Y217F probably benign Het
Prl6a1 A T 13: 27,498,177 (GRCm39) probably benign Het
Ptprg T A 14: 12,154,131 (GRCm38) S617R probably benign Het
R3hdm2 G A 10: 127,280,313 (GRCm39) G45D probably damaging Het
Rev1 T A 1: 38,098,204 (GRCm39) R780W probably null Het
Rnf139 T A 15: 58,771,676 (GRCm39) F567Y probably damaging Het
Scarf1 T C 11: 75,405,174 (GRCm39) V71A probably damaging Het
Shtn1 A G 19: 58,988,372 (GRCm39) S438P probably damaging Het
Slc30a3 T A 5: 31,246,067 (GRCm39) H221L probably benign Het
Smo A C 6: 29,753,603 (GRCm39) I160L possibly damaging Het
Snapc5 A T 9: 64,086,582 (GRCm39) probably benign Het
Snf8 G T 11: 95,925,799 (GRCm39) probably benign Het
Spata31d1a T C 13: 59,850,245 (GRCm39) S628G probably benign Het
Sphkap A T 1: 83,258,145 (GRCm39) D199E probably damaging Het
Spring1 T C 5: 118,397,154 (GRCm39) Y128H probably damaging Het
Stxbp5l T C 16: 37,024,883 (GRCm39) T572A possibly damaging Het
Thada C A 17: 84,723,731 (GRCm39) V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 (GRCm39) Q735R probably benign Het
Trim24 G A 6: 37,848,169 (GRCm39) E42K probably benign Het
Trnt1 T A 6: 106,754,869 (GRCm39) probably benign Het
Ttbk2 A T 2: 120,604,353 (GRCm39) M215K probably damaging Het
Ttc8 C T 12: 98,909,718 (GRCm39) probably benign Het
Ube3c A G 5: 29,795,926 (GRCm39) Y105C probably damaging Het
Unc13c A G 9: 73,438,265 (GRCm39) probably benign Het
Vcf2 C T X: 149,181,360 (GRCm39) A144T probably benign Het
Vmn2r102 T C 17: 19,899,106 (GRCm39) S483P possibly damaging Het
Wdr95 A G 5: 149,511,595 (GRCm39) T432A probably damaging Het
Wnk1 G T 6: 119,903,644 (GRCm39) P2523H probably damaging Het
Xpo4 A G 14: 57,875,665 (GRCm39) probably benign Het
Zar1 G T 5: 72,737,886 (GRCm39) P71Q probably damaging Het
Zbtb41 T C 1: 139,351,348 (GRCm39) Y154H probably benign Het
Zer1 G T 2: 29,994,809 (GRCm39) probably benign Het
Zfp454 A G 11: 50,765,012 (GRCm39) F140S probably benign Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118,155,646 (GRCm39) missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118,176,786 (GRCm39) missense probably damaging 1.00
IGL01720:Usp36 APN 11 118,165,828 (GRCm39) missense probably damaging 0.99
IGL02410:Usp36 APN 11 118,167,011 (GRCm39) missense probably damaging 1.00
IGL02700:Usp36 APN 11 118,166,983 (GRCm39) missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118,155,609 (GRCm39) missense probably benign 0.22
IGL03145:Usp36 APN 11 118,170,067 (GRCm39) missense probably damaging 1.00
IGL03203:Usp36 APN 11 118,176,636 (GRCm39) missense probably benign 0.42
IGL03265:Usp36 APN 11 118,155,635 (GRCm39) missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R0499:Usp36 UTSW 11 118,164,397 (GRCm39) missense probably damaging 0.98
R0646:Usp36 UTSW 11 118,163,847 (GRCm39) missense probably damaging 1.00
R1579:Usp36 UTSW 11 118,175,771 (GRCm39) missense probably damaging 1.00
R1646:Usp36 UTSW 11 118,164,392 (GRCm39) missense probably damaging 1.00
R1716:Usp36 UTSW 11 118,162,957 (GRCm39) critical splice donor site probably null
R1886:Usp36 UTSW 11 118,163,784 (GRCm39) missense probably damaging 1.00
R2014:Usp36 UTSW 11 118,153,334 (GRCm39) splice site probably benign
R2068:Usp36 UTSW 11 118,165,844 (GRCm39) missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118,159,491 (GRCm39) missense probably benign 0.02
R2191:Usp36 UTSW 11 118,175,849 (GRCm39) missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118,167,582 (GRCm39) splice site probably benign
R3176:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3177:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3276:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3277:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3615:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3616:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3768:Usp36 UTSW 11 118,153,878 (GRCm39) missense probably damaging 1.00
R3899:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118,176,621 (GRCm39) missense probably damaging 0.99
R4809:Usp36 UTSW 11 118,153,896 (GRCm39) missense probably damaging 1.00
R5135:Usp36 UTSW 11 118,155,731 (GRCm39) missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R6226:Usp36 UTSW 11 118,168,100 (GRCm39) missense probably damaging 1.00
R6266:Usp36 UTSW 11 118,159,411 (GRCm39) missense probably damaging 1.00
R7191:Usp36 UTSW 11 118,159,660 (GRCm39) missense probably benign 0.39
R7215:Usp36 UTSW 11 118,155,980 (GRCm39) missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118,164,355 (GRCm39) missense probably damaging 1.00
R7535:Usp36 UTSW 11 118,152,872 (GRCm39) missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118,154,522 (GRCm39) missense probably benign 0.11
R7843:Usp36 UTSW 11 118,176,791 (GRCm39) missense probably damaging 1.00
R8228:Usp36 UTSW 11 118,155,716 (GRCm39) missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118,165,840 (GRCm39) missense probably damaging 1.00
R8935:Usp36 UTSW 11 118,167,657 (GRCm39) critical splice acceptor site probably null
R8995:Usp36 UTSW 11 118,175,825 (GRCm39) missense probably damaging 1.00
R9024:Usp36 UTSW 11 118,166,983 (GRCm39) missense possibly damaging 0.95
R9325:Usp36 UTSW 11 118,160,031 (GRCm39) missense possibly damaging 0.69
R9529:Usp36 UTSW 11 118,159,461 (GRCm39) nonsense probably null
R9774:Usp36 UTSW 11 118,153,875 (GRCm39) missense probably damaging 1.00
X0020:Usp36 UTSW 11 118,164,439 (GRCm39) missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118,167,026 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCCACTTTAGGAAAAGGCCC -3'
(R):5'- TTCCGCAATGCCAAGACCAGGATG -3'

Sequencing Primer
(F):5'- GGAAAAGGCCCTTTTGTTCAC -3'
(R):5'- GACCAGGATGCGTGGTG -3'
Posted On 2013-07-11