Incidental Mutation 'R6959:Sarnp'
ID 541661
Institutional Source Beutler Lab
Gene Symbol Sarnp
Ensembl Gene ENSMUSG00000078427
Gene Name SAP domain containing ribonucleoprotein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock # R6959 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 128817333-128877629 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128848268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000151317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105230] [ENSMUST00000219512] [ENSMUST00000220381]
AlphaFold Q9D1J3
Predicted Effect probably benign
Transcript: ENSMUST00000105230
AA Change: V112A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100863
Gene: ENSMUSG00000078427
AA Change: V112A

DomainStartEndE-ValueType
SAP 8 42 2.49e-10 SMART
low complexity region 43 80 N/A INTRINSIC
internal_repeat_1 117 130 5.45e-5 PROSPERO
low complexity region 165 180 N/A INTRINSIC
internal_repeat_1 197 210 5.45e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000219512
AA Change: V29A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220381
AA Change: V111A

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is upregulated in response to various cytokines. The encoded protein may play a role in cell cycle progression. A translocation between this gene and the myeloid/lymphoid leukemia gene, resulting in expression of a chimeric protein, has been associated with acute myelomonocytic leukemia. Pseudogenes exist on chromosomes 7 and 8. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Sarnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Sarnp APN 10 128839854 missense probably benign 0.38
PIT4151001:Sarnp UTSW 10 128877366 missense probably benign 0.18
R1781:Sarnp UTSW 10 128833322 missense probably damaging 1.00
R4560:Sarnp UTSW 10 128846543 missense probably damaging 1.00
R4864:Sarnp UTSW 10 128833343 missense probably damaging 1.00
R5498:Sarnp UTSW 10 128853194 missense probably benign 0.25
R5832:Sarnp UTSW 10 128848312 critical splice donor site probably null
R5936:Sarnp UTSW 10 128848771 missense probably benign 0.04
R7367:Sarnp UTSW 10 128833378 missense probably damaging 1.00
R7476:Sarnp UTSW 10 128833354 missense probably benign 0.00
R9002:Sarnp UTSW 10 128821973 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGTTAAGCCTTAGAATGGCTGC -3'
(R):5'- TGGCAAAACTCAGTGAAAGC -3'

Sequencing Primer
(F):5'- AAGCCTTAGAATGGCTGCTACCTG -3'
(R):5'- TGTCCTGAGTATGACCCAAACTG -3'
Posted On 2018-11-28