Incidental Mutation 'R0606:Actn1'
ID 54167
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Name actinin, alpha 1
Synonyms 3110023F10Rik
MMRRC Submission 038795-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R0606 (G1)
Quality Score 128
Status Validated
Chromosome 12
Chromosomal Location 80214321-80307145 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 80221421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
AlphaFold Q7TPR4
Predicted Effect probably benign
Transcript: ENSMUST00000021554
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167327
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219634
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,572 (GRCm39) Y211H probably damaging Het
Adtrp A G 13: 41,920,881 (GRCm39) F197L probably damaging Het
Ankrd11 G A 8: 123,619,571 (GRCm39) T1406I probably benign Het
Arhgap24 A T 5: 103,045,086 (GRCm39) R620W probably damaging Het
Atg13 A G 2: 91,512,418 (GRCm39) Y284H probably benign Het
Atrn A G 2: 130,748,776 (GRCm39) E99G possibly damaging Het
Cage1 A T 13: 38,200,470 (GRCm39) probably benign Het
Cblif A T 19: 11,729,658 (GRCm39) I206F possibly damaging Het
Ccr3 T A 9: 123,828,839 (GRCm39) M58K probably benign Het
Cdk18 G T 1: 132,045,355 (GRCm39) probably benign Het
Chst5 A G 8: 112,617,551 (GRCm39) V23A probably benign Het
Col4a3 T C 1: 82,650,307 (GRCm39) probably benign Het
Col4a6 A G X: 139,975,219 (GRCm39) probably benign Het
Csmd3 T C 15: 48,321,058 (GRCm39) I251V probably benign Het
Csnk1g3 G A 18: 54,050,100 (GRCm39) V115M probably damaging Het
Cst7 A T 2: 150,412,439 (GRCm39) M1L probably benign Het
Cyp4f17 A T 17: 32,746,817 (GRCm39) D373V probably damaging Het
Dclk2 G A 3: 86,813,311 (GRCm39) R212W probably damaging Het
Dhrs7b T G 11: 60,721,572 (GRCm39) probably benign Het
Dhx58 T A 11: 100,593,077 (GRCm39) H210L probably benign Het
Dnah9 T C 11: 65,732,159 (GRCm39) Y4249C probably damaging Het
Eif5b T A 1: 38,087,974 (GRCm39) L990H probably damaging Het
Faap24 T C 7: 35,094,388 (GRCm39) probably benign Het
Fryl T A 5: 73,282,077 (GRCm39) H174L probably benign Het
Gabrr1 T C 4: 33,132,696 (GRCm39) W15R probably benign Het
Gm15446 T C 5: 110,091,347 (GRCm39) V533A probably benign Het
Gm6760 T A X: 63,195,259 (GRCm39) K63* probably null Het
Gne C T 4: 44,042,244 (GRCm39) E444K possibly damaging Het
Gpr173 T A X: 151,130,036 (GRCm39) M146L possibly damaging Het
Hira C T 16: 18,753,797 (GRCm39) S547L probably benign Het
Hnf1b A G 11: 83,754,810 (GRCm39) H161R probably benign Het
Hnrnpm T A 17: 33,877,364 (GRCm39) N53I probably damaging Het
Hs3st5 A T 10: 36,708,584 (GRCm39) I40F probably benign Het
Hydin C T 8: 111,276,430 (GRCm39) probably benign Het
Ift172 A G 5: 31,411,657 (GRCm39) I1607T probably damaging Het
Igfn1 T C 1: 135,887,639 (GRCm39) Q2475R probably damaging Het
Il6st T C 13: 112,640,806 (GRCm39) S800P possibly damaging Het
Iqub G A 6: 24,501,260 (GRCm39) probably benign Het
Itgb1 A T 8: 129,448,853 (GRCm39) probably benign Het
Kctd21 G A 7: 96,996,808 (GRCm39) E94K probably benign Het
Kir3dl2 A G X: 135,354,260 (GRCm39) V233A possibly damaging Het
Klra2 A T 6: 131,197,187 (GRCm39) C271S probably damaging Het
Lacc1 A T 14: 77,267,061 (GRCm39) C401S probably damaging Het
Lmna T C 3: 88,389,885 (GRCm39) E580G probably damaging Het
Matn2 A G 15: 34,345,296 (GRCm39) Y101C probably damaging Het
Mrps16 G A 14: 20,441,457 (GRCm39) R116* probably null Het
Ndrg2 G T 14: 52,143,674 (GRCm39) R333S probably damaging Het
Nf2 A G 11: 4,732,194 (GRCm39) I507T possibly damaging Het
Nktr A G 9: 121,578,356 (GRCm39) probably benign Het
Nkx3-1 G A 14: 69,428,455 (GRCm39) probably benign Het
Npat T C 9: 53,467,781 (GRCm39) probably null Het
Nrxn1 T C 17: 90,872,801 (GRCm39) N1047S probably damaging Het
Nup210 A T 6: 91,003,911 (GRCm39) I1402N possibly damaging Het
Or5d40 G T 2: 88,015,624 (GRCm39) M134I possibly damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pdcl2 C T 5: 76,460,328 (GRCm39) S182N probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pla2g4a A G 1: 149,716,455 (GRCm39) F669L probably benign Het
Plekha8 A G 6: 54,606,805 (GRCm39) K367E probably damaging Het
Pola1 A G X: 92,531,693 (GRCm39) probably benign Het
Ppm1d C T 11: 85,236,703 (GRCm39) T494I probably benign Het
Pramel16 T A 4: 143,676,453 (GRCm39) Y217F probably benign Het
Prl6a1 A T 13: 27,498,177 (GRCm39) probably benign Het
Ptprg T A 14: 12,154,131 (GRCm38) S617R probably benign Het
R3hdm2 G A 10: 127,280,313 (GRCm39) G45D probably damaging Het
Rev1 T A 1: 38,098,204 (GRCm39) R780W probably null Het
Rnf139 T A 15: 58,771,676 (GRCm39) F567Y probably damaging Het
Scarf1 T C 11: 75,405,174 (GRCm39) V71A probably damaging Het
Shtn1 A G 19: 58,988,372 (GRCm39) S438P probably damaging Het
Slc30a3 T A 5: 31,246,067 (GRCm39) H221L probably benign Het
Smo A C 6: 29,753,603 (GRCm39) I160L possibly damaging Het
Snapc5 A T 9: 64,086,582 (GRCm39) probably benign Het
Snf8 G T 11: 95,925,799 (GRCm39) probably benign Het
Spata31d1a T C 13: 59,850,245 (GRCm39) S628G probably benign Het
Sphkap A T 1: 83,258,145 (GRCm39) D199E probably damaging Het
Spring1 T C 5: 118,397,154 (GRCm39) Y128H probably damaging Het
Stxbp5l T C 16: 37,024,883 (GRCm39) T572A possibly damaging Het
Thada C A 17: 84,723,731 (GRCm39) V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 (GRCm39) Q735R probably benign Het
Trim24 G A 6: 37,848,169 (GRCm39) E42K probably benign Het
Trnt1 T A 6: 106,754,869 (GRCm39) probably benign Het
Ttbk2 A T 2: 120,604,353 (GRCm39) M215K probably damaging Het
Ttc8 C T 12: 98,909,718 (GRCm39) probably benign Het
Ube3c A G 5: 29,795,926 (GRCm39) Y105C probably damaging Het
Unc13c A G 9: 73,438,265 (GRCm39) probably benign Het
Usp36 A G 11: 118,153,854 (GRCm39) probably benign Het
Vcf2 C T X: 149,181,360 (GRCm39) A144T probably benign Het
Vmn2r102 T C 17: 19,899,106 (GRCm39) S483P possibly damaging Het
Wdr95 A G 5: 149,511,595 (GRCm39) T432A probably damaging Het
Wnk1 G T 6: 119,903,644 (GRCm39) P2523H probably damaging Het
Xpo4 A G 14: 57,875,665 (GRCm39) probably benign Het
Zar1 G T 5: 72,737,886 (GRCm39) P71Q probably damaging Het
Zbtb41 T C 1: 139,351,348 (GRCm39) Y154H probably benign Het
Zer1 G T 2: 29,994,809 (GRCm39) probably benign Het
Zfp454 A G 11: 50,765,012 (GRCm39) F140S probably benign Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80,245,846 (GRCm39) splice site probably null
IGL01152:Actn1 APN 12 80,245,820 (GRCm39) missense probably damaging 1.00
IGL01386:Actn1 APN 12 80,240,446 (GRCm39) missense probably benign 0.03
IGL01890:Actn1 APN 12 80,231,642 (GRCm39) missense probably damaging 0.99
IGL01937:Actn1 APN 12 80,218,537 (GRCm39) missense probably benign 0.03
IGL02142:Actn1 APN 12 80,222,929 (GRCm39) critical splice donor site probably null
IGL02191:Actn1 APN 12 80,220,883 (GRCm39) missense probably benign
IGL02217:Actn1 APN 12 80,220,868 (GRCm39) nonsense probably null
IGL02230:Actn1 APN 12 80,218,604 (GRCm39) missense probably benign 0.02
IGL03163:Actn1 APN 12 80,228,191 (GRCm39) missense probably benign 0.33
IGL03401:Actn1 APN 12 80,215,741 (GRCm39) nonsense probably null
R0538:Actn1 UTSW 12 80,306,874 (GRCm39) unclassified probably benign
R0546:Actn1 UTSW 12 80,225,208 (GRCm39) missense probably benign
R0583:Actn1 UTSW 12 80,245,803 (GRCm39) missense probably damaging 1.00
R1340:Actn1 UTSW 12 80,219,918 (GRCm39) critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80,251,852 (GRCm39) missense probably damaging 1.00
R1572:Actn1 UTSW 12 80,219,731 (GRCm39) splice site probably benign
R1619:Actn1 UTSW 12 80,219,796 (GRCm39) missense probably damaging 1.00
R1677:Actn1 UTSW 12 80,306,806 (GRCm39) missense probably benign 0.02
R1994:Actn1 UTSW 12 80,251,745 (GRCm39) nonsense probably null
R2102:Actn1 UTSW 12 80,230,291 (GRCm39) missense probably benign 0.38
R2157:Actn1 UTSW 12 80,219,891 (GRCm39) missense probably benign 0.04
R2191:Actn1 UTSW 12 80,218,576 (GRCm39) nonsense probably null
R2519:Actn1 UTSW 12 80,239,163 (GRCm39) missense probably damaging 1.00
R2988:Actn1 UTSW 12 80,239,162 (GRCm39) missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80,215,251 (GRCm39) missense probably damaging 1.00
R4589:Actn1 UTSW 12 80,218,573 (GRCm39) missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80,228,188 (GRCm39) missense probably damaging 0.99
R4936:Actn1 UTSW 12 80,219,772 (GRCm39) missense probably benign 0.09
R4966:Actn1 UTSW 12 80,219,904 (GRCm39) missense probably benign 0.01
R4972:Actn1 UTSW 12 80,219,813 (GRCm39) missense probably benign 0.35
R5395:Actn1 UTSW 12 80,217,477 (GRCm39) missense probably benign
R5460:Actn1 UTSW 12 80,230,342 (GRCm39) missense probably benign 0.00
R5467:Actn1 UTSW 12 80,222,991 (GRCm39) missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80,215,715 (GRCm39) missense probably damaging 0.99
R5661:Actn1 UTSW 12 80,231,618 (GRCm39) missense probably benign 0.09
R5985:Actn1 UTSW 12 80,215,169 (GRCm39) missense probably damaging 1.00
R6020:Actn1 UTSW 12 80,221,229 (GRCm39) splice site probably null
R6042:Actn1 UTSW 12 80,224,023 (GRCm39) missense probably benign 0.04
R6389:Actn1 UTSW 12 80,221,296 (GRCm39) missense probably benign
R6499:Actn1 UTSW 12 80,215,191 (GRCm39) missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80,240,418 (GRCm39) missense probably damaging 1.00
R7016:Actn1 UTSW 12 80,219,742 (GRCm39) missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80,251,751 (GRCm39) missense probably damaging 1.00
R7173:Actn1 UTSW 12 80,224,033 (GRCm39) missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80,215,706 (GRCm39) missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80,220,859 (GRCm39) missense probably benign 0.00
R7361:Actn1 UTSW 12 80,240,489 (GRCm39) missense probably benign 0.01
R7452:Actn1 UTSW 12 80,230,376 (GRCm39) missense probably benign 0.12
R7698:Actn1 UTSW 12 80,221,311 (GRCm39) missense probably benign 0.00
R7701:Actn1 UTSW 12 80,221,328 (GRCm39) missense possibly damaging 0.88
R8000:Actn1 UTSW 12 80,245,782 (GRCm39) missense probably damaging 1.00
R8171:Actn1 UTSW 12 80,243,167 (GRCm39) critical splice donor site probably null
R8287:Actn1 UTSW 12 80,220,852 (GRCm39) critical splice donor site probably null
R8469:Actn1 UTSW 12 80,240,457 (GRCm39) missense possibly damaging 0.95
R8794:Actn1 UTSW 12 80,245,754 (GRCm39) critical splice donor site probably benign
R8887:Actn1 UTSW 12 80,215,197 (GRCm39) missense probably damaging 1.00
R9237:Actn1 UTSW 12 80,240,470 (GRCm39) missense possibly damaging 0.92
R9269:Actn1 UTSW 12 80,219,745 (GRCm39) missense probably benign 0.01
R9520:Actn1 UTSW 12 80,240,417 (GRCm39) missense probably damaging 1.00
R9526:Actn1 UTSW 12 80,230,393 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCACATGGTCCCATTTGCCATTG -3'
(R):5'- TGAGTGTACCAGCCCTCAACTCAG -3'

Sequencing Primer
(F):5'- CCATTGATCTCCTGAGGCG -3'
(R):5'- GCTGGCTCTGCCTTTGC -3'
Posted On 2013-07-11