Incidental Mutation 'R6959:Btnl2'
ID 541683
Institutional Source Beutler Lab
Gene Symbol Btnl2
Ensembl Gene ENSMUSG00000024340
Gene Name butyrophilin-like 2
Synonyms BTLN2, NG9, BTL-II, butyrophylin-like MHC class II associated
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6959 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34354822-34369493 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34363359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 300 (V300M)
Ref Sequence ENSEMBL: ENSMUSP00000137048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025198] [ENSMUST00000178562]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025198
AA Change: V300M

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025198
Gene: ENSMUSG00000024340
AA Change: V300M

DomainStartEndE-ValueType
IG 35 140 2.16e-8 SMART
Blast:IG_like 150 236 4e-12 BLAST
IGv 262 343 2.89e-9 SMART
Pfam:C2-set_2 361 446 2.6e-6 PFAM
transmembrane domain 457 479 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178562
AA Change: V300M

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137048
Gene: ENSMUSG00000024340
AA Change: V300M

DomainStartEndE-ValueType
IG 35 140 2.16e-8 SMART
Pfam:Ig_3 144 222 5.1e-4 PFAM
Pfam:C2-set_2 146 229 1.8e-6 PFAM
IGv 262 343 2.89e-9 SMART
Pfam:C2-set_2 360 446 3.7e-8 PFAM
Pfam:Ig_2 364 452 4.5e-2 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Btnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02251:Btnl2 APN 17 34363239 nonsense probably null
IGL02252:Btnl2 APN 17 34365390 missense possibly damaging 0.82
IGL02651:Btnl2 APN 17 34356222 start codon destroyed probably null 1.00
IGL02892:Btnl2 APN 17 34362668 missense possibly damaging 0.61
IGL02939:Btnl2 APN 17 34361069 missense probably benign 0.02
IGL03098:Btnl2 UTSW 17 34365216 missense probably benign 0.20
R0504:Btnl2 UTSW 17 34358117 missense probably benign 0.17
R0706:Btnl2 UTSW 17 34368662 missense probably benign 0.21
R1460:Btnl2 UTSW 17 34366450 missense probably benign
R1590:Btnl2 UTSW 17 34361140 missense possibly damaging 0.86
R1597:Btnl2 UTSW 17 34363237 missense probably damaging 1.00
R1880:Btnl2 UTSW 17 34365363 missense possibly damaging 0.89
R3009:Btnl2 UTSW 17 34363518 missense probably damaging 0.99
R3160:Btnl2 UTSW 17 34358065 missense probably damaging 1.00
R3162:Btnl2 UTSW 17 34358065 missense probably damaging 1.00
R3722:Btnl2 UTSW 17 34358135 missense possibly damaging 0.74
R4760:Btnl2 UTSW 17 34363195 missense probably damaging 0.99
R4786:Btnl2 UTSW 17 34363348 missense probably damaging 1.00
R4839:Btnl2 UTSW 17 34365286 nonsense probably null
R5456:Btnl2 UTSW 17 34363321 missense probably benign 0.05
R7011:Btnl2 UTSW 17 34363513 missense probably damaging 1.00
R7650:Btnl2 UTSW 17 34358129 missense probably damaging 1.00
R7785:Btnl2 UTSW 17 34361163 missense probably benign 0.28
R7822:Btnl2 UTSW 17 34363314 missense possibly damaging 0.91
R7988:Btnl2 UTSW 17 34358275 missense possibly damaging 0.87
R8051:Btnl2 UTSW 17 34363499 missense probably damaging 1.00
R8165:Btnl2 UTSW 17 34368708 missense possibly damaging 0.62
R8272:Btnl2 UTSW 17 34356301 critical splice donor site probably null
R8531:Btnl2 UTSW 17 34358054 missense probably benign 0.15
Z1177:Btnl2 UTSW 17 34363519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCTTCCGTTAGCGTAATCGGAC -3'
(R):5'- CCACAGTGTTAGGAAGCTGGAG -3'

Sequencing Primer
(F):5'- GTTAGCGTAATCGGACATTCCCAG -3'
(R):5'- AAAGATCCACCTGGTATCCTTAC -3'
Posted On 2018-11-28