Incidental Mutation 'R6960:B3galt1'
ID541690
Institutional Source Beutler Lab
Gene Symbol B3galt1
Ensembl Gene ENSMUSG00000034780
Gene NameUDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Synonyms6330417G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6960 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location67565871-68122689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68118689 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 249 (E249D)
Ref Sequence ENSEMBL: ENSMUSP00000107965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042456] [ENSMUST00000112346] [ENSMUST00000180887]
Predicted Effect probably damaging
Transcript: ENSMUST00000042456
AA Change: E249D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041343
Gene: ENSMUSG00000034780
AA Change: E249D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Galactosyl_T 92 283 5.4e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112346
AA Change: E249D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107965
Gene: ENSMUSG00000034780
AA Change: E249D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Galactosyl_T 92 283 6.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180887
SMART Domains Protein: ENSMUSP00000137947
Gene: ENSMUSG00000034780

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is expressed exclusively in the brain. The encoded protein shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,072,924 D1170G probably benign Het
Ak7 A T 12: 105,710,244 T68S probably benign Het
Arhgap12 A T 18: 6,111,901 N26K probably damaging Het
Catsper4 T A 4: 134,227,337 M1L probably benign Het
Cc2d2b T C 19: 40,785,062 V523A possibly damaging Het
Cyp11a1 T C 9: 58,018,376 F98S probably damaging Het
Cyp2d26 T C 15: 82,790,245 S479G probably damaging Het
Dclre1a T G 19: 56,542,709 Y735S probably damaging Het
Dio2 C T 12: 90,729,897 G106R probably damaging Het
Efcab12 T C 6: 115,838,312 probably benign Het
Ehhadh C A 16: 21,762,278 V655L probably benign Het
Ercc2 G A 7: 19,393,690 R379Q probably damaging Het
Fabp4 A G 3: 10,208,477 V12A probably benign Het
Fbn1 T C 2: 125,382,060 I590V probably benign Het
Grm8 C A 6: 27,981,282 V210L probably damaging Het
Jakmip3 A G 7: 139,023,336 D359G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Ly75 A T 2: 60,306,405 Y1493N probably benign Het
Lyst A G 13: 13,634,078 N111S probably benign Het
Lyz2 G C 10: 117,278,702 I107M possibly damaging Het
Mgat5 A T 1: 127,320,634 D91V possibly damaging Het
Mical3 T A 6: 120,958,543 D1674V probably damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Naa16 A G 14: 79,359,471 Y358H possibly damaging Het
Nktr T A 9: 121,742,692 H226Q probably damaging Het
Ocln T G 13: 100,498,872 K503T possibly damaging Het
Olfm4 T C 14: 80,021,314 L301S probably damaging Het
Olfr1289 G A 2: 111,483,726 V127I possibly damaging Het
Olfr821 T C 10: 130,034,103 L159P probably benign Het
Paqr4 G A 17: 23,737,723 A222V probably benign Het
Pcdhb13 A G 18: 37,443,456 T296A probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Pigg T C 5: 108,326,841 V309A probably damaging Het
Ptger4 T C 15: 5,234,715 R462G probably benign Het
Ptprc C T 1: 138,078,445 probably null Het
Rabggta A C 14: 55,721,842 probably null Het
Rnf25 A G 1: 74,595,244 S207P possibly damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Rtf1 A G 2: 119,711,078 Q264R probably damaging Het
Ryr2 A G 13: 11,801,243 V619A probably benign Het
Serpinb6d A G 13: 33,671,198 N285S probably benign Het
Slamf6 A G 1: 171,917,753 M16V probably damaging Het
Slc22a23 A G 13: 34,344,157 probably null Het
Slc23a2 T C 2: 132,091,253 D95G probably damaging Het
Smc3 T C 19: 53,629,371 Y600H probably damaging Het
Tarbp1 G A 8: 126,429,039 T1320M possibly damaging Het
Tigd4 A T 3: 84,594,116 K113N probably damaging Het
Tjp1 A T 7: 65,303,015 F1444I possibly damaging Het
Tstd3 A T 4: 21,767,118 M1K probably null Het
Wisp1 C T 15: 66,919,198 T283M probably benign Het
Zbtb46 T C 2: 181,423,424 D311G probably damaging Het
Other mutations in B3galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:B3galt1 APN 2 68117976 missense possibly damaging 0.94
IGL00834:B3galt1 APN 2 68118706 missense probably damaging 1.00
IGL02555:B3galt1 APN 2 68118561 missense probably benign 0.41
IGL02678:B3galt1 APN 2 68118910 missense probably benign 0.28
IGL02904:B3galt1 APN 2 68118745 missense probably damaging 0.99
IGL02931:B3galt1 APN 2 68118384 missense probably damaging 1.00
IGL03231:B3galt1 APN 2 68118603 missense probably damaging 1.00
R0483:B3galt1 UTSW 2 68118588 missense probably benign
R0735:B3galt1 UTSW 2 68118579 missense possibly damaging 0.46
R4946:B3galt1 UTSW 2 68118569 missense possibly damaging 0.91
R5327:B3galt1 UTSW 2 68118768 missense probably damaging 1.00
R5638:B3galt1 UTSW 2 68118751 missense probably damaging 0.99
R6364:B3galt1 UTSW 2 68118672 missense probably damaging 1.00
R7578:B3galt1 UTSW 2 68118552 missense probably damaging 1.00
R8112:B3galt1 UTSW 2 68118358 missense probably damaging 1.00
R8115:B3galt1 UTSW 2 68117976 missense possibly damaging 0.83
Z1177:B3galt1 UTSW 2 68117990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCATGAAAACCGACAGTG -3'
(R):5'- CTTCTGGAGAGATCTGGTGGAC -3'

Sequencing Primer
(F):5'- CCGACAGTGACATTTTTGTGAAC -3'
(R):5'- CTGGTGGACAGTGATGACGC -3'
Posted On2018-11-28