Incidental Mutation 'R6960:Abca1'
ID541699
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6960 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53072924 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1170 (D1170G)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably benign
Transcript: ENSMUST00000030010
AA Change: D1170G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: D1170G

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A T 12: 105,710,244 T68S probably benign Het
Arhgap12 A T 18: 6,111,901 N26K probably damaging Het
B3galt1 A T 2: 68,118,689 E249D probably damaging Het
Catsper4 T A 4: 134,227,337 M1L probably benign Het
Cc2d2b T C 19: 40,785,062 V523A possibly damaging Het
Cyp11a1 T C 9: 58,018,376 F98S probably damaging Het
Cyp2d26 T C 15: 82,790,245 S479G probably damaging Het
Dclre1a T G 19: 56,542,709 Y735S probably damaging Het
Dio2 C T 12: 90,729,897 G106R probably damaging Het
Efcab12 T C 6: 115,838,312 probably benign Het
Ehhadh C A 16: 21,762,278 V655L probably benign Het
Ercc2 G A 7: 19,393,690 R379Q probably damaging Het
Fabp4 A G 3: 10,208,477 V12A probably benign Het
Fbn1 T C 2: 125,382,060 I590V probably benign Het
Grm8 C A 6: 27,981,282 V210L probably damaging Het
Jakmip3 A G 7: 139,023,336 D359G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Ly75 A T 2: 60,306,405 Y1493N probably benign Het
Lyst A G 13: 13,634,078 N111S probably benign Het
Lyz2 G C 10: 117,278,702 I107M possibly damaging Het
Mgat5 A T 1: 127,320,634 D91V possibly damaging Het
Mical3 T A 6: 120,958,543 D1674V probably damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Naa16 A G 14: 79,359,471 Y358H possibly damaging Het
Nktr T A 9: 121,742,692 H226Q probably damaging Het
Ocln T G 13: 100,498,872 K503T possibly damaging Het
Olfm4 T C 14: 80,021,314 L301S probably damaging Het
Olfr1289 G A 2: 111,483,726 V127I possibly damaging Het
Olfr821 T C 10: 130,034,103 L159P probably benign Het
Paqr4 G A 17: 23,737,723 A222V probably benign Het
Pcdhb13 A G 18: 37,443,456 T296A probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Pigg T C 5: 108,326,841 V309A probably damaging Het
Ptger4 T C 15: 5,234,715 R462G probably benign Het
Ptprc C T 1: 138,078,445 probably null Het
Rabggta A C 14: 55,721,842 probably null Het
Rnf25 A G 1: 74,595,244 S207P possibly damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Rtf1 A G 2: 119,711,078 Q264R probably damaging Het
Ryr2 A G 13: 11,801,243 V619A probably benign Het
Serpinb6d A G 13: 33,671,198 N285S probably benign Het
Slamf6 A G 1: 171,917,753 M16V probably damaging Het
Slc22a23 A G 13: 34,344,157 probably null Het
Slc23a2 T C 2: 132,091,253 D95G probably damaging Het
Smc3 T C 19: 53,629,371 Y600H probably damaging Het
Tarbp1 G A 8: 126,429,039 T1320M possibly damaging Het
Tigd4 A T 3: 84,594,116 K113N probably damaging Het
Tjp1 A T 7: 65,303,015 F1444I possibly damaging Het
Tstd3 A T 4: 21,767,118 M1K probably null Het
Wisp1 C T 15: 66,919,198 T283M probably benign Het
Zbtb46 T C 2: 181,423,424 D311G probably damaging Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
R7863:Abca1 UTSW 4 53107179 missense probably benign
R7877:Abca1 UTSW 4 53046135 missense possibly damaging 0.55
R7946:Abca1 UTSW 4 53107179 missense probably benign
R7960:Abca1 UTSW 4 53046135 missense possibly damaging 0.55
RF005:Abca1 UTSW 4 53049125 missense probably damaging 0.97
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CAGCAAGTGTTAGGCCAAGC -3'
(R):5'- AGTGGTCTCTGAAGCCATGG -3'

Sequencing Primer
(F):5'- GGCTACATCCACTCCCACGG -3'
(R):5'- ACACTTCCCAGGGAAAGCTTTC -3'
Posted On2018-11-28