Incidental Mutation 'R6960:Ercc2'
ID541704
Institutional Source Beutler Lab
Gene Symbol Ercc2
Ensembl Gene ENSMUSG00000030400
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 2
SynonymsXPD, Ercc-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6960 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19382010-19395694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19393690 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 379 (R379Q)
Ref Sequence ENSEMBL: ENSMUSP00000104101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047170] [ENSMUST00000062831] [ENSMUST00000108457] [ENSMUST00000108458] [ENSMUST00000108459] [ENSMUST00000108460] [ENSMUST00000108461]
Predicted Effect probably benign
Transcript: ENSMUST00000047170
SMART Domains Protein: ENSMUSP00000038091
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062831
AA Change: R631Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054380
Gene: ENSMUSG00000030400
AA Change: R631Q

DomainStartEndE-ValueType
DEXDc 8 280 1.62e-144 SMART
Blast:DEXDc2 340 369 3e-10 BLAST
Blast:DEXDc 412 467 9e-27 BLAST
HELICc 542 686 1.32e-76 SMART
low complexity region 733 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108457
SMART Domains Protein: ENSMUSP00000104097
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.7e-57 PFAM
Pfam:TPR_10 206 247 3.2e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108458
SMART Domains Protein: ENSMUSP00000104098
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108459
SMART Domains Protein: ENSMUSP00000104099
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
coiled coil region 88 150 N/A INTRINSIC
low complexity region 157 173 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
Pfam:TPR_10 206 247 5.6e-7 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108460
AA Change: R610Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104100
Gene: ENSMUSG00000030400
AA Change: R610Q

DomainStartEndE-ValueType
DEXDc 8 259 1.7e-120 SMART
Blast:DEXDc2 319 348 3e-10 BLAST
Blast:DEXDc 391 446 8e-27 BLAST
HELICc 521 665 1.32e-76 SMART
low complexity region 712 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108461
AA Change: R379Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104101
Gene: ENSMUSG00000030400
AA Change: R379Q

DomainStartEndE-ValueType
Pfam:DUF1227 16 161 4.5e-60 PFAM
Blast:HELICc2 193 262 1e-40 BLAST
HELICc 290 434 1.32e-76 SMART
low complexity region 481 499 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117840
Gene: ENSMUSG00000030400
AA Change: R554Q

DomainStartEndE-ValueType
DEXDc 10 204 1.14e-71 SMART
Blast:DEXDc2 264 293 2e-10 BLAST
Blast:DEXDc 336 391 5e-27 BLAST
HELICc 466 610 1.32e-76 SMART
low complexity region 657 675 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die prior to implantation. Homozygotes for a targeted missense mutation exhibit brittle and greying hair, cachexia, infertility, osteosclerosis, osteoporosis, reduced lifespan, UV sensitivity, and skin defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,072,924 D1170G probably benign Het
Ak7 A T 12: 105,710,244 T68S probably benign Het
Arhgap12 A T 18: 6,111,901 N26K probably damaging Het
B3galt1 A T 2: 68,118,689 E249D probably damaging Het
Catsper4 T A 4: 134,227,337 M1L probably benign Het
Cc2d2b T C 19: 40,785,062 V523A possibly damaging Het
Cyp11a1 T C 9: 58,018,376 F98S probably damaging Het
Cyp2d26 T C 15: 82,790,245 S479G probably damaging Het
Dclre1a T G 19: 56,542,709 Y735S probably damaging Het
Dio2 C T 12: 90,729,897 G106R probably damaging Het
Efcab12 T C 6: 115,838,312 probably benign Het
Ehhadh C A 16: 21,762,278 V655L probably benign Het
Fabp4 A G 3: 10,208,477 V12A probably benign Het
Fbn1 T C 2: 125,382,060 I590V probably benign Het
Grm8 C A 6: 27,981,282 V210L probably damaging Het
Jakmip3 A G 7: 139,023,336 D359G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Ly75 A T 2: 60,306,405 Y1493N probably benign Het
Lyst A G 13: 13,634,078 N111S probably benign Het
Lyz2 G C 10: 117,278,702 I107M possibly damaging Het
Mgat5 A T 1: 127,320,634 D91V possibly damaging Het
Mical3 T A 6: 120,958,543 D1674V probably damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Naa16 A G 14: 79,359,471 Y358H possibly damaging Het
Nktr T A 9: 121,742,692 H226Q probably damaging Het
Ocln T G 13: 100,498,872 K503T possibly damaging Het
Olfm4 T C 14: 80,021,314 L301S probably damaging Het
Olfr1289 G A 2: 111,483,726 V127I possibly damaging Het
Olfr821 T C 10: 130,034,103 L159P probably benign Het
Paqr4 G A 17: 23,737,723 A222V probably benign Het
Pcdhb13 A G 18: 37,443,456 T296A probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Pigg T C 5: 108,326,841 V309A probably damaging Het
Ptger4 T C 15: 5,234,715 R462G probably benign Het
Ptprc C T 1: 138,078,445 probably null Het
Rabggta A C 14: 55,721,842 probably null Het
Rnf25 A G 1: 74,595,244 S207P possibly damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Rtf1 A G 2: 119,711,078 Q264R probably damaging Het
Ryr2 A G 13: 11,801,243 V619A probably benign Het
Serpinb6d A G 13: 33,671,198 N285S probably benign Het
Slamf6 A G 1: 171,917,753 M16V probably damaging Het
Slc22a23 A G 13: 34,344,157 probably null Het
Slc23a2 T C 2: 132,091,253 D95G probably damaging Het
Smc3 T C 19: 53,629,371 Y600H probably damaging Het
Tarbp1 G A 8: 126,429,039 T1320M possibly damaging Het
Tigd4 A T 3: 84,594,116 K113N probably damaging Het
Tjp1 A T 7: 65,303,015 F1444I possibly damaging Het
Tstd3 A T 4: 21,767,118 M1K probably null Het
Wisp1 C T 15: 66,919,198 T283M probably benign Het
Zbtb46 T C 2: 181,423,424 D311G probably damaging Het
Other mutations in Ercc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ercc2 APN 7 19390417 missense probably benign 0.03
IGL01767:Ercc2 APN 7 19390421 missense probably damaging 1.00
IGL01810:Ercc2 APN 7 19393449 missense probably damaging 1.00
IGL02485:Ercc2 APN 7 19394045 missense possibly damaging 0.83
IGL02891:Ercc2 APN 7 19393286 missense probably damaging 1.00
IGL03010:Ercc2 APN 7 19391566 missense possibly damaging 0.89
R0304:Ercc2 UTSW 7 19386708 missense possibly damaging 0.75
R0512:Ercc2 UTSW 7 19393887 missense probably damaging 0.99
R1467:Ercc2 UTSW 7 19385886 missense probably benign 0.05
R1467:Ercc2 UTSW 7 19385886 missense probably benign 0.05
R1600:Ercc2 UTSW 7 19385941 missense probably benign 0.00
R1636:Ercc2 UTSW 7 19387124 missense possibly damaging 0.94
R2156:Ercc2 UTSW 7 19386792 missense possibly damaging 0.95
R2446:Ercc2 UTSW 7 19386944 missense probably damaging 0.97
R4458:Ercc2 UTSW 7 19393846 missense probably damaging 1.00
R4869:Ercc2 UTSW 7 19386807 missense probably damaging 1.00
R5861:Ercc2 UTSW 7 19394141 missense possibly damaging 0.91
R7301:Ercc2 UTSW 7 19394135 missense probably benign 0.09
R7354:Ercc2 UTSW 7 19393654 missense possibly damaging 0.91
R8485:Ercc2 UTSW 7 19388240 missense possibly damaging 0.89
Z1176:Ercc2 UTSW 7 19385668 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGAGTAGACCTGACTCTTAGCTC -3'
(R):5'- ACCATGAGTCCATAGTCCGTC -3'

Sequencing Primer
(F):5'- GACTCTTAGCTCAGGTTCCTG -3'
(R):5'- ATGAGTCCATAGTCCGTCTTGCC -3'
Posted On2018-11-28