Mutagenetix > Incidental Mutation

Incidental Mutation 'R6960:Naa16'

541723

Institutional Source

Beutler Lab

Gene Symbol

Naa16

Ensembl Gene

ENSMUSG00000022020

Gene Name

N(alpha)-acetyltransferase 16, NatA auxiliary subunit

Synonyms

Narg1l, 1300019C06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R6960 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79325269-79390778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79359471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 358 (Y358H)

Ref Sequence

ENSEMBL: ENSMUSP00000022597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486]

AlphaFold

Q9DBB4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022597
AA Change: Y358H

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: Y358H

Domain	Start	End	E-Value	Type
TPR	46	79	2.99e1	SMART
TPR	80	113	2.98e-3	SMART
Blast:TPR	224	257	1e-10	BLAST
TPR	374	407	9.96e0	SMART
TPR	408	441	7.47e0	SMART
low complexity region	616	633	N/A	INTRINSIC
Blast:TPR	672	705	3e-12	BLAST
low complexity region	830	841	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163486
AA Change: Y324H

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020
AA Change: Y324H

Domain	Start	End	E-Value	Type
TPR	12	45	2.99e1	SMART
TPR	46	79	2.98e-3	SMART
Blast:TPR	190	223	3e-10	BLAST
TPR	340	373	9.96e0	SMART
TPR	374	407	7.47e0	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

98% (50/51)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	T	C	4: 53,072,924	D1170G	probably benign	Het
Ak7	A	T	12: 105,710,244	T68S	probably benign	Het
Arhgap12	A	T	18: 6,111,901	N26K	probably damaging	Het
B3galt1	A	T	2: 68,118,689	E249D	probably damaging	Het
Catsper4	T	A	4: 134,227,337	M1L	probably benign	Het
Cc2d2b	T	C	19: 40,785,062	V523A	possibly damaging	Het
Cyp11a1	T	C	9: 58,018,376	F98S	probably damaging	Het
Cyp2d26	T	C	15: 82,790,245	S479G	probably damaging	Het
Dclre1a	T	G	19: 56,542,709	Y735S	probably damaging	Het
Dio2	C	T	12: 90,729,897	G106R	probably damaging	Het
Efcab12	T	C	6: 115,838,312		probably benign	Het
Ehhadh	C	A	16: 21,762,278	V655L	probably benign	Het
Ercc2	G	A	7: 19,393,690	R379Q	probably damaging	Het
Fabp4	A	G	3: 10,208,477	V12A	probably benign	Het
Fbn1	T	C	2: 125,382,060	I590V	probably benign	Het
Grm8	C	A	6: 27,981,282	V210L	probably damaging	Het
Jakmip3	A	G	7: 139,023,336	D359G	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Ly75	A	T	2: 60,306,405	Y1493N	probably benign	Het
Lyst	A	G	13: 13,634,078	N111S	probably benign	Het
Lyz2	G	C	10: 117,278,702	I107M	possibly damaging	Het
Mgat5	A	T	1: 127,320,634	D91V	possibly damaging	Het
Mical3	T	A	6: 120,958,543	D1674V	probably damaging	Het
Myom2	G	A	8: 15,117,741	A1109T	probably null	Het
Nktr	T	A	9: 121,742,692	H226Q	probably damaging	Het
Ocln	T	G	13: 100,498,872	K503T	possibly damaging	Het
Olfm4	T	C	14: 80,021,314	L301S	probably damaging	Het
Olfr1289	G	A	2: 111,483,726	V127I	possibly damaging	Het
Olfr821	T	C	10: 130,034,103	L159P	probably benign	Het
Paqr4	G	A	17: 23,737,723	A222V	probably benign	Het
Pcdhb13	A	G	18: 37,443,456	T296A	probably benign	Het
Phka2	G	A	X: 160,533,048	V230I	probably damaging	Het
Pigg	T	C	5: 108,326,841	V309A	probably damaging	Het
Ptger4	T	C	15: 5,234,715	R462G	probably benign	Het
Ptprc	C	T	1: 138,078,445		probably null	Het
Rabggta	A	C	14: 55,721,842		probably null	Het
Rnf25	A	G	1: 74,595,244	S207P	possibly damaging	Het
Rsf1	G	GACGGCGGCC	7: 97,579,909		probably benign	Het
Rtf1	A	G	2: 119,711,078	Q264R	probably damaging	Het
Ryr2	A	G	13: 11,801,243	V619A	probably benign	Het
Serpinb6d	A	G	13: 33,671,198	N285S	probably benign	Het
Slamf6	A	G	1: 171,917,753	M16V	probably damaging	Het
Slc22a23	A	G	13: 34,344,157		probably null	Het
Slc23a2	T	C	2: 132,091,253	D95G	probably damaging	Het
Smc3	T	C	19: 53,629,371	Y600H	probably damaging	Het
Tarbp1	G	A	8: 126,429,039	T1320M	possibly damaging	Het
Tigd4	A	T	3: 84,594,116	K113N	probably damaging	Het
Tjp1	A	T	7: 65,303,015	F1444I	possibly damaging	Het
Tstd3	A	T	4: 21,767,118	M1K	probably null	Het
Wisp1	C	T	15: 66,919,198	T283M	probably benign	Het
Zbtb46	T	C	2: 181,423,424	D311G	probably damaging	Het

Other mutations in Naa16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Naa16	APN	14	79355729	missense	probably damaging	1.00
IGL01025:Naa16	APN	14	79384756	missense	probably damaging	1.00
IGL01155:Naa16	APN	14	79384715	missense	probably damaging	0.98
IGL01335:Naa16	APN	14	79345116	splice site	probably benign
IGL01981:Naa16	APN	14	79381516	missense	probably benign	0.05
IGL02230:Naa16	APN	14	79377361	splice site	probably benign
IGL02313:Naa16	APN	14	79384668	missense	probably damaging	1.00
IGL02418:Naa16	APN	14	79383366	missense	probably damaging	1.00
IGL02544:Naa16	APN	14	79335820	missense	probably damaging	1.00
IGL03051:Naa16	APN	14	79369082	missense	probably benign	0.01
IGL03064:Naa16	APN	14	79339628	missense	probably damaging	0.98
IGL03205:Naa16	APN	14	79356512	missense	possibly damaging	0.89
PIT4508001:Naa16	UTSW	14	79369087	missense	probably benign	0.15
R0651:Naa16	UTSW	14	79351392	missense	probably damaging	1.00
R1429:Naa16	UTSW	14	79359527	missense	probably benign	0.01
R1674:Naa16	UTSW	14	79387057	start codon destroyed	probably null	0.65
R1693:Naa16	UTSW	14	79351456	missense	probably damaging	1.00
R1874:Naa16	UTSW	14	79355743	missense	possibly damaging	0.62
R1992:Naa16	UTSW	14	79356491	missense	probably damaging	1.00
R2015:Naa16	UTSW	14	79345059	missense	probably damaging	1.00
R2391:Naa16	UTSW	14	79370049	missense	probably benign	0.16
R2847:Naa16	UTSW	14	79335883	missense	probably damaging	1.00
R2848:Naa16	UTSW	14	79335883	missense	probably damaging	1.00
R2877:Naa16	UTSW	14	79343298	missense	probably benign	0.00
R3884:Naa16	UTSW	14	79343262	missense	probably damaging	0.98
R4001:Naa16	UTSW	14	79343121	splice site	probably null
R4199:Naa16	UTSW	14	79355871	missense	probably damaging	1.00
R4638:Naa16	UTSW	14	79340033	splice site	probably null
R4676:Naa16	UTSW	14	79336348	unclassified	probably benign
R4690:Naa16	UTSW	14	79345057	missense	probably damaging	1.00
R4952:Naa16	UTSW	14	79345085	missense	probably damaging	1.00
R5087:Naa16	UTSW	14	79377415	missense	possibly damaging	0.68
R5104:Naa16	UTSW	14	79384700	nonsense	probably null
R5729:Naa16	UTSW	14	79355780	missense	probably damaging	1.00
R6178:Naa16	UTSW	14	79383340	missense	possibly damaging	0.93
R7794:Naa16	UTSW	14	79377494	missense	probably damaging	1.00
R7936:Naa16	UTSW	14	79341046	missense	possibly damaging	0.47
R8356:Naa16	UTSW	14	79359475	missense	probably benign	0.00
R8456:Naa16	UTSW	14	79359475	missense	probably benign	0.00
R8892:Naa16	UTSW	14	79390576	missense	probably benign	0.32
R8931:Naa16	UTSW	14	79344955	missense	probably damaging	1.00
R9010:Naa16	UTSW	14	79370042	missense	probably benign	0.01
R9068:Naa16	UTSW	14	79374849	missense	probably benign	0.18
R9360:Naa16	UTSW	14	79356503	missense	probably benign	0.05
R9688:Naa16	UTSW	14	79335869	nonsense	probably null
X0064:Naa16	UTSW	14	79351389	missense	probably damaging	1.00
Z1177:Naa16	UTSW	14	79344979	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAACTAAGGCTAATTAACTCCCAGC -3'
(R):5'- AGAGGCACAGTTTCTACTTTCTG -3'

Sequencing Primer
(F):5'- GTCATTTGTGTAGCACACA -3'
(R):5'- CTTAACTCCAGTTTCAGGGGG -3'

Posted On

2018-11-28