Incidental Mutation 'R6960:Naa16'
ID 541723
Institutional Source Beutler Lab
Gene Symbol Naa16
Ensembl Gene ENSMUSG00000022020
Gene Name N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms Narg1l, 1300019C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R6960 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 79325269-79390778 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79359471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 358 (Y358H)
Ref Sequence ENSEMBL: ENSMUSP00000022597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486]
AlphaFold Q9DBB4
Predicted Effect possibly damaging
Transcript: ENSMUST00000022597
AA Change: Y358H

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: Y358H

DomainStartEndE-ValueType
TPR 46 79 2.99e1 SMART
TPR 80 113 2.98e-3 SMART
Blast:TPR 224 257 1e-10 BLAST
TPR 374 407 9.96e0 SMART
TPR 408 441 7.47e0 SMART
low complexity region 616 633 N/A INTRINSIC
Blast:TPR 672 705 3e-12 BLAST
low complexity region 830 841 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163486
AA Change: Y324H

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020
AA Change: Y324H

DomainStartEndE-ValueType
TPR 12 45 2.99e1 SMART
TPR 46 79 2.98e-3 SMART
Blast:TPR 190 223 3e-10 BLAST
TPR 340 373 9.96e0 SMART
TPR 374 407 7.47e0 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,072,924 D1170G probably benign Het
Ak7 A T 12: 105,710,244 T68S probably benign Het
Arhgap12 A T 18: 6,111,901 N26K probably damaging Het
B3galt1 A T 2: 68,118,689 E249D probably damaging Het
Catsper4 T A 4: 134,227,337 M1L probably benign Het
Cc2d2b T C 19: 40,785,062 V523A possibly damaging Het
Cyp11a1 T C 9: 58,018,376 F98S probably damaging Het
Cyp2d26 T C 15: 82,790,245 S479G probably damaging Het
Dclre1a T G 19: 56,542,709 Y735S probably damaging Het
Dio2 C T 12: 90,729,897 G106R probably damaging Het
Efcab12 T C 6: 115,838,312 probably benign Het
Ehhadh C A 16: 21,762,278 V655L probably benign Het
Ercc2 G A 7: 19,393,690 R379Q probably damaging Het
Fabp4 A G 3: 10,208,477 V12A probably benign Het
Fbn1 T C 2: 125,382,060 I590V probably benign Het
Grm8 C A 6: 27,981,282 V210L probably damaging Het
Jakmip3 A G 7: 139,023,336 D359G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Ly75 A T 2: 60,306,405 Y1493N probably benign Het
Lyst A G 13: 13,634,078 N111S probably benign Het
Lyz2 G C 10: 117,278,702 I107M possibly damaging Het
Mgat5 A T 1: 127,320,634 D91V possibly damaging Het
Mical3 T A 6: 120,958,543 D1674V probably damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nktr T A 9: 121,742,692 H226Q probably damaging Het
Ocln T G 13: 100,498,872 K503T possibly damaging Het
Olfm4 T C 14: 80,021,314 L301S probably damaging Het
Olfr1289 G A 2: 111,483,726 V127I possibly damaging Het
Olfr821 T C 10: 130,034,103 L159P probably benign Het
Paqr4 G A 17: 23,737,723 A222V probably benign Het
Pcdhb13 A G 18: 37,443,456 T296A probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Pigg T C 5: 108,326,841 V309A probably damaging Het
Ptger4 T C 15: 5,234,715 R462G probably benign Het
Ptprc C T 1: 138,078,445 probably null Het
Rabggta A C 14: 55,721,842 probably null Het
Rnf25 A G 1: 74,595,244 S207P possibly damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Rtf1 A G 2: 119,711,078 Q264R probably damaging Het
Ryr2 A G 13: 11,801,243 V619A probably benign Het
Serpinb6d A G 13: 33,671,198 N285S probably benign Het
Slamf6 A G 1: 171,917,753 M16V probably damaging Het
Slc22a23 A G 13: 34,344,157 probably null Het
Slc23a2 T C 2: 132,091,253 D95G probably damaging Het
Smc3 T C 19: 53,629,371 Y600H probably damaging Het
Tarbp1 G A 8: 126,429,039 T1320M possibly damaging Het
Tigd4 A T 3: 84,594,116 K113N probably damaging Het
Tjp1 A T 7: 65,303,015 F1444I possibly damaging Het
Tstd3 A T 4: 21,767,118 M1K probably null Het
Wisp1 C T 15: 66,919,198 T283M probably benign Het
Zbtb46 T C 2: 181,423,424 D311G probably damaging Het
Other mutations in Naa16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Naa16 APN 14 79355729 missense probably damaging 1.00
IGL01025:Naa16 APN 14 79384756 missense probably damaging 1.00
IGL01155:Naa16 APN 14 79384715 missense probably damaging 0.98
IGL01335:Naa16 APN 14 79345116 splice site probably benign
IGL01981:Naa16 APN 14 79381516 missense probably benign 0.05
IGL02230:Naa16 APN 14 79377361 splice site probably benign
IGL02313:Naa16 APN 14 79384668 missense probably damaging 1.00
IGL02418:Naa16 APN 14 79383366 missense probably damaging 1.00
IGL02544:Naa16 APN 14 79335820 missense probably damaging 1.00
IGL03051:Naa16 APN 14 79369082 missense probably benign 0.01
IGL03064:Naa16 APN 14 79339628 missense probably damaging 0.98
IGL03205:Naa16 APN 14 79356512 missense possibly damaging 0.89
PIT4508001:Naa16 UTSW 14 79369087 missense probably benign 0.15
R0651:Naa16 UTSW 14 79351392 missense probably damaging 1.00
R1429:Naa16 UTSW 14 79359527 missense probably benign 0.01
R1674:Naa16 UTSW 14 79387057 start codon destroyed probably null 0.65
R1693:Naa16 UTSW 14 79351456 missense probably damaging 1.00
R1874:Naa16 UTSW 14 79355743 missense possibly damaging 0.62
R1992:Naa16 UTSW 14 79356491 missense probably damaging 1.00
R2015:Naa16 UTSW 14 79345059 missense probably damaging 1.00
R2391:Naa16 UTSW 14 79370049 missense probably benign 0.16
R2847:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2848:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2877:Naa16 UTSW 14 79343298 missense probably benign 0.00
R3884:Naa16 UTSW 14 79343262 missense probably damaging 0.98
R4001:Naa16 UTSW 14 79343121 splice site probably null
R4199:Naa16 UTSW 14 79355871 missense probably damaging 1.00
R4638:Naa16 UTSW 14 79340033 splice site probably null
R4676:Naa16 UTSW 14 79336348 unclassified probably benign
R4690:Naa16 UTSW 14 79345057 missense probably damaging 1.00
R4952:Naa16 UTSW 14 79345085 missense probably damaging 1.00
R5087:Naa16 UTSW 14 79377415 missense possibly damaging 0.68
R5104:Naa16 UTSW 14 79384700 nonsense probably null
R5729:Naa16 UTSW 14 79355780 missense probably damaging 1.00
R6178:Naa16 UTSW 14 79383340 missense possibly damaging 0.93
R7794:Naa16 UTSW 14 79377494 missense probably damaging 1.00
R7936:Naa16 UTSW 14 79341046 missense possibly damaging 0.47
R8356:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8456:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8892:Naa16 UTSW 14 79390576 missense probably benign 0.32
R8931:Naa16 UTSW 14 79344955 missense probably damaging 1.00
R9010:Naa16 UTSW 14 79370042 missense probably benign 0.01
R9068:Naa16 UTSW 14 79374849 missense probably benign 0.18
R9360:Naa16 UTSW 14 79356503 missense probably benign 0.05
R9688:Naa16 UTSW 14 79335869 nonsense probably null
X0064:Naa16 UTSW 14 79351389 missense probably damaging 1.00
Z1177:Naa16 UTSW 14 79344979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTAAGGCTAATTAACTCCCAGC -3'
(R):5'- AGAGGCACAGTTTCTACTTTCTG -3'

Sequencing Primer
(F):5'- GTCATTTGTGTAGCACACA -3'
(R):5'- CTTAACTCCAGTTTCAGGGGG -3'
Posted On 2018-11-28