Incidental Mutation 'R6961:Tlr5'
ID541740
Institutional Source Beutler Lab
Gene Symbol Tlr5
Ensembl Gene ENSMUSG00000079164
Gene Nametoll-like receptor 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R6961 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location182954788-182976044 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 182973511 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 127 (R127*)
Ref Sequence ENSEMBL: ENSMUSP00000141318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]
Predicted Effect probably null
Transcript: ENSMUST00000110997
AA Change: R127*
SMART Domains Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: R127*

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 3.11e-2 SMART
LRR 159 183 5.56e0 SMART
LRR 184 207 1.97e2 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 7.05e-1 SMART
LRR 350 373 2.92e1 SMART
LRR 374 397 2.54e1 SMART
LRR 398 418 1.29e2 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 1.06e-4 SMART
LRR 540 563 6.13e-1 SMART
LRR 564 585 2.21e2 SMART
LRRCT 594 645 7.01e-6 SMART
low complexity region 657 676 N/A INTRINSIC
TIR 707 852 3.89e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191820
AA Change: R113*
SMART Domains Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: R113*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
LRR_TYP 95 118 1.3e-4 SMART
LRR 145 169 2.3e-2 SMART
LRR 170 193 8.2e-1 SMART
low complexity region 248 261 N/A INTRINSIC
LRR 312 335 2.9e-3 SMART
LRR 336 359 1.2e-1 SMART
LRR 360 383 1.1e-1 SMART
LRR 384 404 5.4e-1 SMART
low complexity region 427 442 N/A INTRINSIC
LRR_TYP 502 525 4.5e-7 SMART
LRR 526 549 2.5e-3 SMART
LRR 550 571 9.4e-1 SMART
LRRCT 580 631 3.4e-8 SMART
transmembrane domain 642 664 N/A INTRINSIC
TIR 693 838 2.5e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193687
AA Change: R127*
SMART Domains Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: R127*

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 1.3e-4 SMART
LRR 159 183 2.3e-2 SMART
LRR 184 207 8.2e-1 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 2.9e-3 SMART
LRR 350 373 1.2e-1 SMART
LRR 374 397 1.1e-1 SMART
LRR 398 418 5.4e-1 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 4.5e-7 SMART
LRR 540 563 2.5e-3 SMART
LRR 564 585 9.4e-1 SMART
LRRCT 594 645 3.4e-8 SMART
transmembrane domain 656 678 N/A INTRINSIC
TIR 707 852 2.5e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G A 9: 35,908,444 M1I probably null Het
Aasdh A G 5: 76,876,301 L168P probably damaging Het
Atp6v0d1 A G 8: 105,529,217 L173P probably damaging Het
Baiap2l2 A G 15: 79,284,635 F23L probably damaging Het
Ccdc144b T A 3: 36,050,617 I32F possibly damaging Het
Cdh23 G C 10: 60,650,114 L41V probably benign Het
Cep120 C A 18: 53,703,205 E803* probably null Het
Clcn7 C T 17: 25,157,214 P560S probably damaging Het
Cldn12 A T 5: 5,507,707 V240D probably damaging Het
Clec1a C T 6: 129,429,983 E190K probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Crispld1 T A 1: 17,762,141 H450Q probably damaging Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Fam186a T A 15: 99,940,201 I2721F probably benign Het
Fbxl13 A G 5: 21,543,742 F393S probably damaging Het
Fut1 A T 7: 45,619,539 I306F probably damaging Het
Gas2l3 T C 10: 89,413,291 D655G probably benign Het
Gm15448 T C 7: 3,825,125 Y61C probably damaging Het
Gm29106 A T 1: 118,200,398 K607* probably null Het
Gm609 T A 16: 45,444,003 Y64F probably benign Het
Hmg20a T C 9: 56,488,728 V268A probably benign Het
Il2rb T A 15: 78,485,824 Y205F probably damaging Het
Ints4 A G 7: 97,541,190 *965W probably null Het
Itsn2 T A 12: 4,673,420 C1118* probably null Het
Jakmip1 T C 5: 37,173,353 L459P probably damaging Het
Klhl8 T C 5: 103,870,569 T323A possibly damaging Het
Mindy3 C A 2: 12,396,178 probably null Het
Myo3a A G 2: 22,245,558 T79A probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Napa C T 7: 16,109,109 R53* probably null Het
Nudt21 A C 8: 94,028,880 D133E probably benign Het
Olfr1220 T A 2: 89,097,805 M41L probably benign Het
Olfr131 T A 17: 38,082,205 I258F probably damaging Het
Olfr601 A G 7: 103,358,582 V204A possibly damaging Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr690 A T 7: 105,329,706 I162K probably damaging Het
Olfr789 T C 10: 129,487,462 F151L probably damaging Het
Pla2g4e G T 2: 120,174,370 probably null Het
Ptbp1 T C 10: 79,859,277 probably null Het
Scfd2 A C 5: 74,519,541 V317G possibly damaging Het
Slc45a1 T C 4: 150,629,653 M712V probably damaging Het
Smg7 A T 1: 152,841,583 L919* probably null Het
Sspo T A 6: 48,463,877 S1758T probably benign Het
Tgfb2 A T 1: 186,649,835 M165K possibly damaging Het
Tie1 C T 4: 118,486,205 V154M probably damaging Het
Timm17a A G 1: 135,311,078 probably benign Het
Ttc29 A C 8: 78,276,916 I254L possibly damaging Het
Unc79 T C 12: 103,112,915 S1780P probably damaging Het
Vmn2r106 A T 17: 20,268,384 Y584* probably null Het
Zbtb24 A G 10: 41,455,175 E366G probably damaging Het
Other mutations in Tlr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tlr5 APN 1 182973829 missense probably benign
IGL00940:Tlr5 APN 1 182974196 missense possibly damaging 0.84
IGL01302:Tlr5 APN 1 182974748 missense probably benign 0.00
IGL01480:Tlr5 APN 1 182973499 missense probably benign 0.09
IGL01717:Tlr5 APN 1 182975398 missense probably damaging 1.00
IGL01896:Tlr5 APN 1 182974879 missense possibly damaging 0.64
IGL02083:Tlr5 APN 1 182973884 missense possibly damaging 0.91
IGL02135:Tlr5 APN 1 182973254 missense possibly damaging 0.82
R0464:Tlr5 UTSW 1 182973710 missense probably benign 0.01
R0552:Tlr5 UTSW 1 182975696 unclassified probably null
R0556:Tlr5 UTSW 1 182974151 missense probably damaging 1.00
R0639:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R0670:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R1014:Tlr5 UTSW 1 182975677 missense probably benign 0.00
R1125:Tlr5 UTSW 1 182973892 missense probably benign 0.00
R1563:Tlr5 UTSW 1 182975010 missense probably benign 0.09
R1775:Tlr5 UTSW 1 182973722 missense probably damaging 0.99
R1793:Tlr5 UTSW 1 182972447 missense probably benign 0.00
R1991:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R1992:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R2114:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2116:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2225:Tlr5 UTSW 1 182972376 start gained probably benign
R2265:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2266:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2268:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2882:Tlr5 UTSW 1 182973893 missense probably damaging 1.00
R3695:Tlr5 UTSW 1 182975347 missense probably damaging 1.00
R3747:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R3749:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R4084:Tlr5 UTSW 1 182974848 missense possibly damaging 0.60
R4794:Tlr5 UTSW 1 182973896 missense probably benign 0.00
R4895:Tlr5 UTSW 1 182974199 missense probably damaging 1.00
R4964:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R4966:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R5496:Tlr5 UTSW 1 182973632 missense probably damaging 1.00
R6056:Tlr5 UTSW 1 182974038 missense possibly damaging 0.76
R6715:Tlr5 UTSW 1 182972659 intron probably benign
R6825:Tlr5 UTSW 1 182973044 intron probably benign
R7135:Tlr5 UTSW 1 182975523 missense possibly damaging 0.87
R7232:Tlr5 UTSW 1 182973499 missense probably benign 0.09
R7255:Tlr5 UTSW 1 182974316 missense probably damaging 1.00
R7257:Tlr5 UTSW 1 182974233 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAACCTCACCCAGATTCCCTG -3'
(R):5'- TCAGTTCCCGGAATGAAGAATGG -3'

Sequencing Primer
(F):5'- TACTACCACTGAGAGGCTCCTG -3'
(R):5'- CCGGAATGAAGAATGGAGGCG -3'
Posted On2018-11-28