Incidental Mutation 'R6961:Ccdc144b'
ID541745
Institutional Source Beutler Lab
Gene Symbol Ccdc144b
Ensembl Gene ENSMUSG00000047696
Gene Namecoiled-coil domain containing 144B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6961 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location36007244-36053547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36050617 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 32 (I32F)
Ref Sequence ENSEMBL: ENSMUSP00000142406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166644] [ENSMUST00000196964] [ENSMUST00000200469]
Predicted Effect probably benign
Transcript: ENSMUST00000166644
AA Change: I32F

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132995
Gene: ENSMUSG00000047696
AA Change: I32F

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196964
AA Change: I32F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142406
Gene: ENSMUSG00000047696
AA Change: I32F

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200469
AA Change: I32F

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142910
Gene: ENSMUSG00000047696
AA Change: I32F

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Meta Mutation Damage Score 0.0995 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G A 9: 35,908,444 M1I probably null Het
Aasdh A G 5: 76,876,301 L168P probably damaging Het
Atp6v0d1 A G 8: 105,529,217 L173P probably damaging Het
Baiap2l2 A G 15: 79,284,635 F23L probably damaging Het
Cdh23 G C 10: 60,650,114 L41V probably benign Het
Cep120 C A 18: 53,703,205 E803* probably null Het
Clcn7 C T 17: 25,157,214 P560S probably damaging Het
Cldn12 A T 5: 5,507,707 V240D probably damaging Het
Clec1a C T 6: 129,429,983 E190K probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Crispld1 T A 1: 17,762,141 H450Q probably damaging Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Fam186a T A 15: 99,940,201 I2721F probably benign Het
Fbxl13 A G 5: 21,543,742 F393S probably damaging Het
Fut1 A T 7: 45,619,539 I306F probably damaging Het
Gas2l3 T C 10: 89,413,291 D655G probably benign Het
Gm15448 T C 7: 3,825,125 Y61C probably damaging Het
Gm29106 A T 1: 118,200,398 K607* probably null Het
Gm609 T A 16: 45,444,003 Y64F probably benign Het
Hmg20a T C 9: 56,488,728 V268A probably benign Het
Il2rb T A 15: 78,485,824 Y205F probably damaging Het
Ints4 A G 7: 97,541,190 *965W probably null Het
Itsn2 T A 12: 4,673,420 C1118* probably null Het
Jakmip1 T C 5: 37,173,353 L459P probably damaging Het
Klhl8 T C 5: 103,870,569 T323A possibly damaging Het
Mindy3 C A 2: 12,396,178 probably null Het
Myo3a A G 2: 22,245,558 T79A probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Napa C T 7: 16,109,109 R53* probably null Het
Nudt21 A C 8: 94,028,880 D133E probably benign Het
Olfr1220 T A 2: 89,097,805 M41L probably benign Het
Olfr131 T A 17: 38,082,205 I258F probably damaging Het
Olfr601 A G 7: 103,358,582 V204A possibly damaging Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr690 A T 7: 105,329,706 I162K probably damaging Het
Olfr789 T C 10: 129,487,462 F151L probably damaging Het
Pla2g4e G T 2: 120,174,370 probably null Het
Ptbp1 T C 10: 79,859,277 probably null Het
Scfd2 A C 5: 74,519,541 V317G possibly damaging Het
Slc45a1 T C 4: 150,629,653 M712V probably damaging Het
Smg7 A T 1: 152,841,583 L919* probably null Het
Sspo T A 6: 48,463,877 S1758T probably benign Het
Tgfb2 A T 1: 186,649,835 M165K possibly damaging Het
Tie1 C T 4: 118,486,205 V154M probably damaging Het
Timm17a A G 1: 135,311,078 probably benign Het
Tlr5 C T 1: 182,973,511 R127* probably null Het
Ttc29 A C 8: 78,276,916 I254L possibly damaging Het
Unc79 T C 12: 103,112,915 S1780P probably damaging Het
Vmn2r106 A T 17: 20,268,384 Y584* probably null Het
Zbtb24 A G 10: 41,455,175 E366G probably damaging Het
Other mutations in Ccdc144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Ccdc144b APN 3 36019989 missense probably damaging 1.00
IGL00773:Ccdc144b APN 3 36035337 missense probably damaging 1.00
IGL01409:Ccdc144b APN 3 36025928 missense possibly damaging 0.77
IGL01791:Ccdc144b APN 3 36035267 critical splice donor site probably benign 0.00
IGL02307:Ccdc144b APN 3 36018867 missense possibly damaging 0.95
IGL02374:Ccdc144b APN 3 36019959 missense possibly damaging 0.83
IGL02673:Ccdc144b APN 3 36046699 splice site probably benign
IGL02727:Ccdc144b APN 3 36032916 missense possibly damaging 0.66
R0355:Ccdc144b UTSW 3 36046905 splice site probably benign
R0833:Ccdc144b UTSW 3 36020213 splice site probably benign
R0928:Ccdc144b UTSW 3 36025366 missense possibly damaging 0.83
R1595:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R1598:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R2011:Ccdc144b UTSW 3 36010678 nonsense probably null
R2255:Ccdc144b UTSW 3 36019950 missense probably benign 0.00
R2921:Ccdc144b UTSW 3 36025928 missense probably null 0.01
R4659:Ccdc144b UTSW 3 36025954 missense possibly damaging 0.90
R4764:Ccdc144b UTSW 3 36010660 makesense probably null
R4929:Ccdc144b UTSW 3 36035338 missense probably damaging 0.99
R5631:Ccdc144b UTSW 3 36046877 missense probably damaging 0.99
R5755:Ccdc144b UTSW 3 36017693 missense probably benign
R5849:Ccdc144b UTSW 3 36032877 missense possibly damaging 0.81
R5894:Ccdc144b UTSW 3 36019975 missense possibly damaging 0.91
R5968:Ccdc144b UTSW 3 36010691 missense probably benign 0.00
R6963:Ccdc144b UTSW 3 36050662 missense probably benign 0.30
R7248:Ccdc144b UTSW 3 36025937 missense probably benign 0.00
R7380:Ccdc144b UTSW 3 36025921 missense possibly damaging 0.68
R7612:Ccdc144b UTSW 3 36025357 missense possibly damaging 0.79
R7637:Ccdc144b UTSW 3 36046876 missense probably damaging 0.98
X0011:Ccdc144b UTSW 3 36025948 missense possibly damaging 0.66
X0057:Ccdc144b UTSW 3 36018901 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAAGAAGCCAGGGTGTGC -3'
(R):5'- CAGATGGCATGTGGTAAACG -3'

Sequencing Primer
(F):5'- CCACACTGAAGAAATTACAGTAGG -3'
(R):5'- TGGCATGTGGTAAACGATATTAAAG -3'
Posted On2018-11-28