Incidental Mutation 'R6961:Aasdh'
ID541752
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6961 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76876301 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 168 (L168P)
Ref Sequence ENSEMBL: ENSMUSP00000117489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120639] [ENSMUST00000120963] [ENSMUST00000121160] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000149602] [ENSMUST00000163347]
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: L1009P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: L1009P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120639
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: L1009P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: L1009P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121160
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149602
AA Change: L168P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923
AA Change: L168P

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163347
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Meta Mutation Damage Score 0.5175 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G A 9: 35,908,444 M1I probably null Het
Atp6v0d1 A G 8: 105,529,217 L173P probably damaging Het
Baiap2l2 A G 15: 79,284,635 F23L probably damaging Het
Ccdc144b T A 3: 36,050,617 I32F possibly damaging Het
Cdh23 G C 10: 60,650,114 L41V probably benign Het
Cep120 C A 18: 53,703,205 E803* probably null Het
Clcn7 C T 17: 25,157,214 P560S probably damaging Het
Cldn12 A T 5: 5,507,707 V240D probably damaging Het
Clec1a C T 6: 129,429,983 E190K probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Crispld1 T A 1: 17,762,141 H450Q probably damaging Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Fam186a T A 15: 99,940,201 I2721F probably benign Het
Fbxl13 A G 5: 21,543,742 F393S probably damaging Het
Fut1 A T 7: 45,619,539 I306F probably damaging Het
Gas2l3 T C 10: 89,413,291 D655G probably benign Het
Gm15448 T C 7: 3,825,125 Y61C probably damaging Het
Gm29106 A T 1: 118,200,398 K607* probably null Het
Gm609 T A 16: 45,444,003 Y64F probably benign Het
Hmg20a T C 9: 56,488,728 V268A probably benign Het
Il2rb T A 15: 78,485,824 Y205F probably damaging Het
Ints4 A G 7: 97,541,190 *965W probably null Het
Itsn2 T A 12: 4,673,420 C1118* probably null Het
Jakmip1 T C 5: 37,173,353 L459P probably damaging Het
Klhl8 T C 5: 103,870,569 T323A possibly damaging Het
Mindy3 C A 2: 12,396,178 probably null Het
Myo3a A G 2: 22,245,558 T79A probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Napa C T 7: 16,109,109 R53* probably null Het
Nudt21 A C 8: 94,028,880 D133E probably benign Het
Olfr1220 T A 2: 89,097,805 M41L probably benign Het
Olfr131 T A 17: 38,082,205 I258F probably damaging Het
Olfr601 A G 7: 103,358,582 V204A possibly damaging Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr690 A T 7: 105,329,706 I162K probably damaging Het
Olfr789 T C 10: 129,487,462 F151L probably damaging Het
Pla2g4e G T 2: 120,174,370 probably null Het
Ptbp1 T C 10: 79,859,277 probably null Het
Scfd2 A C 5: 74,519,541 V317G possibly damaging Het
Slc45a1 T C 4: 150,629,653 M712V probably damaging Het
Smg7 A T 1: 152,841,583 L919* probably null Het
Sspo T A 6: 48,463,877 S1758T probably benign Het
Tgfb2 A T 1: 186,649,835 M165K possibly damaging Het
Tie1 C T 4: 118,486,205 V154M probably damaging Het
Timm17a A G 1: 135,311,078 probably benign Het
Tlr5 C T 1: 182,973,511 R127* probably null Het
Ttc29 A C 8: 78,276,916 I254L possibly damaging Het
Unc79 T C 12: 103,112,915 S1780P probably damaging Het
Vmn2r106 A T 17: 20,268,384 Y584* probably null Het
Zbtb24 A G 10: 41,455,175 E366G probably damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCCCAGACCACAGGAGAG -3'
(R):5'- CATCTGGATGAAGAGACCCC -3'

Sequencing Primer
(F):5'- CCACAGGAGAGGAGAAGACTTC -3'
(R):5'- ACCCCGTTGGACTCAAGAGTTG -3'
Posted On2018-11-28