Incidental Mutation 'R6961:Hmg20a'
ID541767
Institutional Source Beutler Lab
Gene Symbol Hmg20a
Ensembl Gene ENSMUSG00000032329
Gene Namehigh mobility group 20A
SynonymsHmgxb1, 5730490E10Rik, 1200004E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6961 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location56418609-56496936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56488728 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 268 (V268A)
Ref Sequence ENSEMBL: ENSMUSP00000149359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034879] [ENSMUST00000215269] [ENSMUST00000217518]
Predicted Effect probably benign
Transcript: ENSMUST00000034879
AA Change: V268A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034879
Gene: ENSMUSG00000032329
AA Change: V268A

DomainStartEndE-ValueType
low complexity region 80 94 N/A INTRINSIC
HMG 101 171 1.86e-21 SMART
coiled coil region 228 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215269
AA Change: V268A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000217518
AA Change: V268A

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik G A 9: 35,908,444 M1I probably null Het
Aasdh A G 5: 76,876,301 L168P probably damaging Het
Atp6v0d1 A G 8: 105,529,217 L173P probably damaging Het
Baiap2l2 A G 15: 79,284,635 F23L probably damaging Het
Ccdc144b T A 3: 36,050,617 I32F possibly damaging Het
Cdh23 G C 10: 60,650,114 L41V probably benign Het
Cep120 C A 18: 53,703,205 E803* probably null Het
Clcn7 C T 17: 25,157,214 P560S probably damaging Het
Cldn12 A T 5: 5,507,707 V240D probably damaging Het
Clec1a C T 6: 129,429,983 E190K probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Crispld1 T A 1: 17,762,141 H450Q probably damaging Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Fam186a T A 15: 99,940,201 I2721F probably benign Het
Fbxl13 A G 5: 21,543,742 F393S probably damaging Het
Fut1 A T 7: 45,619,539 I306F probably damaging Het
Gas2l3 T C 10: 89,413,291 D655G probably benign Het
Gm15448 T C 7: 3,825,125 Y61C probably damaging Het
Gm29106 A T 1: 118,200,398 K607* probably null Het
Gm609 T A 16: 45,444,003 Y64F probably benign Het
Il2rb T A 15: 78,485,824 Y205F probably damaging Het
Ints4 A G 7: 97,541,190 *965W probably null Het
Itsn2 T A 12: 4,673,420 C1118* probably null Het
Jakmip1 T C 5: 37,173,353 L459P probably damaging Het
Klhl8 T C 5: 103,870,569 T323A possibly damaging Het
Mindy3 C A 2: 12,396,178 probably null Het
Myo3a A G 2: 22,245,558 T79A probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Napa C T 7: 16,109,109 R53* probably null Het
Nudt21 A C 8: 94,028,880 D133E probably benign Het
Olfr1220 T A 2: 89,097,805 M41L probably benign Het
Olfr131 T A 17: 38,082,205 I258F probably damaging Het
Olfr601 A G 7: 103,358,582 V204A possibly damaging Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr690 A T 7: 105,329,706 I162K probably damaging Het
Olfr789 T C 10: 129,487,462 F151L probably damaging Het
Pla2g4e G T 2: 120,174,370 probably null Het
Ptbp1 T C 10: 79,859,277 probably null Het
Scfd2 A C 5: 74,519,541 V317G possibly damaging Het
Slc45a1 T C 4: 150,629,653 M712V probably damaging Het
Smg7 A T 1: 152,841,583 L919* probably null Het
Sspo T A 6: 48,463,877 S1758T probably benign Het
Tgfb2 A T 1: 186,649,835 M165K possibly damaging Het
Tie1 C T 4: 118,486,205 V154M probably damaging Het
Timm17a A G 1: 135,311,078 probably benign Het
Tlr5 C T 1: 182,973,511 R127* probably null Het
Ttc29 A C 8: 78,276,916 I254L possibly damaging Het
Unc79 T C 12: 103,112,915 S1780P probably damaging Het
Vmn2r106 A T 17: 20,268,384 Y584* probably null Het
Zbtb24 A G 10: 41,455,175 E366G probably damaging Het
Other mutations in Hmg20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Hmg20a APN 9 56487650 missense probably damaging 1.00
IGL01981:Hmg20a APN 9 56477230 missense probably damaging 1.00
IGL02085:Hmg20a APN 9 56477302 nonsense probably null
IGL03284:Hmg20a APN 9 56481617 missense probably benign 0.25
ANU22:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
P0033:Hmg20a UTSW 9 56489824 missense probably benign 0.01
R0369:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
R0710:Hmg20a UTSW 9 56474670 missense possibly damaging 0.84
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1546:Hmg20a UTSW 9 56467401 missense possibly damaging 0.56
R2188:Hmg20a UTSW 9 56477300 missense possibly damaging 0.93
R4730:Hmg20a UTSW 9 56467419 missense possibly damaging 0.85
R4956:Hmg20a UTSW 9 56481664 missense probably damaging 1.00
R6115:Hmg20a UTSW 9 56489832 missense possibly damaging 0.95
R6130:Hmg20a UTSW 9 56488607 splice site probably null
R6152:Hmg20a UTSW 9 56481608 missense probably damaging 1.00
R7499:Hmg20a UTSW 9 56488943 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGAGACAGCTAAGCAGAACTTC -3'
(R):5'- TGCGGCTTCTCCACATTAATAC -3'

Sequencing Primer
(F):5'- CTAAGCAGAACTTCATAGAAGAGTC -3'
(R):5'- GCGGCTTCTCCACATTAATACTAACG -3'
Posted On2018-11-28