Incidental Mutation 'R6961:Clcn7'
ID 541779
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Name chloride channel, voltage-sensitive 7
Synonyms ClC-7
MMRRC Submission 045071-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6961 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25352365-25381078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 25376188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 560 (P560S)
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000160961]
AlphaFold O70496
Predicted Effect probably damaging
Transcript: ENSMUST00000040729
AA Change: P580S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: P580S

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160961
AA Change: P560S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: P560S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636
AA Change: P292S

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,024,148 (GRCm39) L168P probably damaging Het
Atp6v0d1 A G 8: 106,255,849 (GRCm39) L173P probably damaging Het
Baiap2l2 A G 15: 79,168,835 (GRCm39) F23L probably damaging Het
Cd200l1 T A 16: 45,264,366 (GRCm39) Y64F probably benign Het
Cdh23 G C 10: 60,485,893 (GRCm39) L41V probably benign Het
Cep120 C A 18: 53,836,277 (GRCm39) E803* probably null Het
Cldn12 A T 5: 5,557,707 (GRCm39) V240D probably damaging Het
Clec1a C T 6: 129,406,946 (GRCm39) E190K probably benign Het
Cntnap5b A G 1: 100,202,197 (GRCm39) E348G probably benign Het
Crispld1 T A 1: 17,832,365 (GRCm39) H450Q probably damaging Het
Dsc2 A T 18: 20,171,279 (GRCm39) N573K probably damaging Het
Fam186a T A 15: 99,838,082 (GRCm39) I2721F probably benign Het
Fbxl13 A G 5: 21,748,740 (GRCm39) F393S probably damaging Het
Fut1 A T 7: 45,268,963 (GRCm39) I306F probably damaging Het
Gas2l3 T C 10: 89,249,153 (GRCm39) D655G probably benign Het
Gm29106 A T 1: 118,128,128 (GRCm39) K607* probably null Het
Gm57858 T A 3: 36,104,766 (GRCm39) I32F possibly damaging Het
Hmg20a T C 9: 56,396,012 (GRCm39) V268A probably benign Het
Il2rb T A 15: 78,370,024 (GRCm39) Y205F probably damaging Het
Ints4 A G 7: 97,190,397 (GRCm39) *965W probably null Het
Itsn2 T A 12: 4,723,420 (GRCm39) C1118* probably null Het
Jakmip1 T C 5: 37,330,697 (GRCm39) L459P probably damaging Het
Klhl8 T C 5: 104,018,435 (GRCm39) T323A possibly damaging Het
Mindy3 C A 2: 12,400,989 (GRCm39) probably null Het
Myo3a A G 2: 22,250,369 (GRCm39) T79A probably benign Het
Myom2 G A 8: 15,167,741 (GRCm39) A1109T probably null Het
Napa C T 7: 15,843,034 (GRCm39) R53* probably null Het
Nudt21 A C 8: 94,755,508 (GRCm39) D133E probably benign Het
Or2y3 T A 17: 38,393,096 (GRCm39) I258F probably damaging Het
Or4c115 T A 2: 88,928,149 (GRCm39) M41L probably benign Het
Or52b1 A T 7: 104,978,913 (GRCm39) I162K probably damaging Het
Or52s19 A G 7: 103,007,789 (GRCm39) V204A possibly damaging Het
Or56a41 A T 7: 104,741,978 (GRCm39) M16K probably benign Het
Or6c7 T C 10: 129,323,331 (GRCm39) F151L probably damaging Het
Pate13 G A 9: 35,819,740 (GRCm39) M1I probably null Het
Pira13 T C 7: 3,828,124 (GRCm39) Y61C probably damaging Het
Pla2g4e G T 2: 120,004,851 (GRCm39) probably null Het
Ptbp1 T C 10: 79,695,111 (GRCm39) probably null Het
Scfd2 A C 5: 74,680,202 (GRCm39) V317G possibly damaging Het
Slc45a1 T C 4: 150,714,110 (GRCm39) M712V probably damaging Het
Smg7 A T 1: 152,717,334 (GRCm39) L919* probably null Het
Sspo T A 6: 48,440,811 (GRCm39) S1758T probably benign Het
Tgfb2 A T 1: 186,382,032 (GRCm39) M165K possibly damaging Het
Tie1 C T 4: 118,343,402 (GRCm39) V154M probably damaging Het
Timm17a A G 1: 135,238,816 (GRCm39) probably benign Het
Tlr5 C T 1: 182,801,076 (GRCm39) R127* probably null Het
Ttc29 A C 8: 79,003,545 (GRCm39) I254L possibly damaging Het
Unc79 T C 12: 103,079,174 (GRCm39) S1780P probably damaging Het
Vmn2r106 A T 17: 20,488,646 (GRCm39) Y584* probably null Het
Zbtb24 A G 10: 41,331,171 (GRCm39) E366G probably damaging Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25,370,097 (GRCm39) missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25,370,090 (GRCm39) missense probably benign 0.13
IGL01912:Clcn7 APN 17 25,371,983 (GRCm39) splice site probably benign
IGL01936:Clcn7 APN 17 25,374,350 (GRCm39) missense probably benign 0.44
IGL02084:Clcn7 APN 17 25,376,899 (GRCm39) missense probably benign
IGL02121:Clcn7 APN 17 25,372,058 (GRCm39) missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25,368,004 (GRCm39) unclassified probably benign
IGL02335:Clcn7 APN 17 25,365,821 (GRCm39) missense probably benign 0.00
IGL02507:Clcn7 APN 17 25,363,443 (GRCm39) missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25,365,792 (GRCm39) missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25,365,427 (GRCm39) unclassified probably benign
IGL03192:Clcn7 APN 17 25,352,575 (GRCm39) missense probably benign 0.00
IGL03194:Clcn7 APN 17 25,369,522 (GRCm39) missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25,374,359 (GRCm39) missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25,372,728 (GRCm39) missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25,368,176 (GRCm39) unclassified probably benign
R0970:Clcn7 UTSW 17 25,370,208 (GRCm39) critical splice donor site probably null
R1644:Clcn7 UTSW 17 25,378,672 (GRCm39) missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25,379,445 (GRCm39) missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25,363,425 (GRCm39) missense probably benign
R2173:Clcn7 UTSW 17 25,364,583 (GRCm39) missense probably benign
R2401:Clcn7 UTSW 17 25,372,114 (GRCm39) missense probably benign 0.02
R2511:Clcn7 UTSW 17 25,374,420 (GRCm39) missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25,378,681 (GRCm39) missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25,379,150 (GRCm39) missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25,376,935 (GRCm39) missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25,372,539 (GRCm39) intron probably benign
R5372:Clcn7 UTSW 17 25,376,153 (GRCm39) missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25,368,026 (GRCm39) missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25,376,928 (GRCm39) missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25,370,702 (GRCm39) missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25,376,502 (GRCm39) missense probably benign 0.01
R6798:Clcn7 UTSW 17 25,378,734 (GRCm39) missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25,365,325 (GRCm39) missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25,372,667 (GRCm39) missense
R7757:Clcn7 UTSW 17 25,375,796 (GRCm39) missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25,368,233 (GRCm39) nonsense probably null
R8670:Clcn7 UTSW 17 25,378,588 (GRCm39) missense probably damaging 0.99
R9031:Clcn7 UTSW 17 25,376,497 (GRCm39) missense probably damaging 0.96
R9720:Clcn7 UTSW 17 25,374,471 (GRCm39) missense probably damaging 1.00
X0020:Clcn7 UTSW 17 25,369,200 (GRCm39) missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25,371,989 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCATCAGGTCCATAGCAC -3'
(R):5'- TGACTCAATGGGCTCCCTTC -3'

Sequencing Primer
(F):5'- GTAGGGCTCAGCAGTTAGC -3'
(R):5'- AATGGGCTCCCTTCCTTCTG -3'
Posted On 2018-11-28