Mutagenetix > Incidental Mutation

Incidental Mutation 'R6961:Dsc2'

541781

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20038222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 573 (N573K)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: N573K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: N573K

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: N573K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: N573K

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230113P08Rik	G	A	9: 35,908,444	M1I	probably null	Het
Aasdh	A	G	5: 76,876,301	L168P	probably damaging	Het
Atp6v0d1	A	G	8: 105,529,217	L173P	probably damaging	Het
Baiap2l2	A	G	15: 79,284,635	F23L	probably damaging	Het
Ccdc144b	T	A	3: 36,050,617	I32F	possibly damaging	Het
Cdh23	G	C	10: 60,650,114	L41V	probably benign	Het
Cep120	C	A	18: 53,703,205	E803*	probably null	Het
Clcn7	C	T	17: 25,157,214	P560S	probably damaging	Het
Cldn12	A	T	5: 5,507,707	V240D	probably damaging	Het
Clec1a	C	T	6: 129,429,983	E190K	probably benign	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Crispld1	T	A	1: 17,762,141	H450Q	probably damaging	Het
Fam186a	T	A	15: 99,940,201	I2721F	probably benign	Het
Fbxl13	A	G	5: 21,543,742	F393S	probably damaging	Het
Fut1	A	T	7: 45,619,539	I306F	probably damaging	Het
Gas2l3	T	C	10: 89,413,291	D655G	probably benign	Het
Gm15448	T	C	7: 3,825,125	Y61C	probably damaging	Het
Gm29106	A	T	1: 118,200,398	K607*	probably null	Het
Gm609	T	A	16: 45,444,003	Y64F	probably benign	Het
Hmg20a	T	C	9: 56,488,728	V268A	probably benign	Het
Il2rb	T	A	15: 78,485,824	Y205F	probably damaging	Het
Ints4	A	G	7: 97,541,190	*965W	probably null	Het
Itsn2	T	A	12: 4,673,420	C1118*	probably null	Het
Jakmip1	T	C	5: 37,173,353	L459P	probably damaging	Het
Klhl8	T	C	5: 103,870,569	T323A	possibly damaging	Het
Mindy3	C	A	2: 12,396,178		probably null	Het
Myo3a	A	G	2: 22,245,558	T79A	probably benign	Het
Myom2	G	A	8: 15,117,741	A1109T	probably null	Het
Napa	C	T	7: 16,109,109	R53*	probably null	Het
Nudt21	A	C	8: 94,028,880	D133E	probably benign	Het
Olfr1220	T	A	2: 89,097,805	M41L	probably benign	Het
Olfr131	T	A	17: 38,082,205	I258F	probably damaging	Het
Olfr601	A	G	7: 103,358,582	V204A	possibly damaging	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr690	A	T	7: 105,329,706	I162K	probably damaging	Het
Olfr789	T	C	10: 129,487,462	F151L	probably damaging	Het
Pla2g4e	G	T	2: 120,174,370		probably null	Het
Ptbp1	T	C	10: 79,859,277		probably null	Het
Scfd2	A	C	5: 74,519,541	V317G	possibly damaging	Het
Slc45a1	T	C	4: 150,629,653	M712V	probably damaging	Het
Smg7	A	T	1: 152,841,583	L919*	probably null	Het
Sspo	T	A	6: 48,463,877	S1758T	probably benign	Het
Tgfb2	A	T	1: 186,649,835	M165K	possibly damaging	Het
Tie1	C	T	4: 118,486,205	V154M	probably damaging	Het
Timm17a	A	G	1: 135,311,078		probably benign	Het
Tlr5	C	T	1: 182,973,511	R127*	probably null	Het
Ttc29	A	C	8: 78,276,916	I254L	possibly damaging	Het
Unc79	T	C	12: 103,112,915	S1780P	probably damaging	Het
Vmn2r106	A	T	17: 20,268,384	Y584*	probably null	Het
Zbtb24	A	G	10: 41,455,175	E366G	probably damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCAATATTTGAAAGCGCATACC -3'
(R):5'- AGTGTTCCCAGCGTTGTTGC -3'

Sequencing Primer
(F):5'- AGCGCATACCATTGATTCTTG -3'
(R):5'- CAGCGTTGTTGCTCATGAC -3'

Posted On

2018-11-28