Incidental Mutation 'R6961:Cep120'
ID 541782
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Name centrosomal protein 120
Synonyms Ccdc100
MMRRC Submission 045071-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.773) question?
Stock # R6961 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 53814795-53877680 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 53836277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 803 (E803*)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
AlphaFold Q7TSG1
Predicted Effect probably null
Transcript: ENSMUST00000049811
AA Change: E803*
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: E803*

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,024,148 (GRCm39) L168P probably damaging Het
Atp6v0d1 A G 8: 106,255,849 (GRCm39) L173P probably damaging Het
Baiap2l2 A G 15: 79,168,835 (GRCm39) F23L probably damaging Het
Cd200l1 T A 16: 45,264,366 (GRCm39) Y64F probably benign Het
Cdh23 G C 10: 60,485,893 (GRCm39) L41V probably benign Het
Clcn7 C T 17: 25,376,188 (GRCm39) P560S probably damaging Het
Cldn12 A T 5: 5,557,707 (GRCm39) V240D probably damaging Het
Clec1a C T 6: 129,406,946 (GRCm39) E190K probably benign Het
Cntnap5b A G 1: 100,202,197 (GRCm39) E348G probably benign Het
Crispld1 T A 1: 17,832,365 (GRCm39) H450Q probably damaging Het
Dsc2 A T 18: 20,171,279 (GRCm39) N573K probably damaging Het
Fam186a T A 15: 99,838,082 (GRCm39) I2721F probably benign Het
Fbxl13 A G 5: 21,748,740 (GRCm39) F393S probably damaging Het
Fut1 A T 7: 45,268,963 (GRCm39) I306F probably damaging Het
Gas2l3 T C 10: 89,249,153 (GRCm39) D655G probably benign Het
Gm29106 A T 1: 118,128,128 (GRCm39) K607* probably null Het
Gm57858 T A 3: 36,104,766 (GRCm39) I32F possibly damaging Het
Hmg20a T C 9: 56,396,012 (GRCm39) V268A probably benign Het
Il2rb T A 15: 78,370,024 (GRCm39) Y205F probably damaging Het
Ints4 A G 7: 97,190,397 (GRCm39) *965W probably null Het
Itsn2 T A 12: 4,723,420 (GRCm39) C1118* probably null Het
Jakmip1 T C 5: 37,330,697 (GRCm39) L459P probably damaging Het
Klhl8 T C 5: 104,018,435 (GRCm39) T323A possibly damaging Het
Mindy3 C A 2: 12,400,989 (GRCm39) probably null Het
Myo3a A G 2: 22,250,369 (GRCm39) T79A probably benign Het
Myom2 G A 8: 15,167,741 (GRCm39) A1109T probably null Het
Napa C T 7: 15,843,034 (GRCm39) R53* probably null Het
Nudt21 A C 8: 94,755,508 (GRCm39) D133E probably benign Het
Or2y3 T A 17: 38,393,096 (GRCm39) I258F probably damaging Het
Or4c115 T A 2: 88,928,149 (GRCm39) M41L probably benign Het
Or52b1 A T 7: 104,978,913 (GRCm39) I162K probably damaging Het
Or52s19 A G 7: 103,007,789 (GRCm39) V204A possibly damaging Het
Or56a41 A T 7: 104,741,978 (GRCm39) M16K probably benign Het
Or6c7 T C 10: 129,323,331 (GRCm39) F151L probably damaging Het
Pate13 G A 9: 35,819,740 (GRCm39) M1I probably null Het
Pira13 T C 7: 3,828,124 (GRCm39) Y61C probably damaging Het
Pla2g4e G T 2: 120,004,851 (GRCm39) probably null Het
Ptbp1 T C 10: 79,695,111 (GRCm39) probably null Het
Scfd2 A C 5: 74,680,202 (GRCm39) V317G possibly damaging Het
Slc45a1 T C 4: 150,714,110 (GRCm39) M712V probably damaging Het
Smg7 A T 1: 152,717,334 (GRCm39) L919* probably null Het
Sspo T A 6: 48,440,811 (GRCm39) S1758T probably benign Het
Tgfb2 A T 1: 186,382,032 (GRCm39) M165K possibly damaging Het
Tie1 C T 4: 118,343,402 (GRCm39) V154M probably damaging Het
Timm17a A G 1: 135,238,816 (GRCm39) probably benign Het
Tlr5 C T 1: 182,801,076 (GRCm39) R127* probably null Het
Ttc29 A C 8: 79,003,545 (GRCm39) I254L possibly damaging Het
Unc79 T C 12: 103,079,174 (GRCm39) S1780P probably damaging Het
Vmn2r106 A T 17: 20,488,646 (GRCm39) Y584* probably null Het
Zbtb24 A G 10: 41,331,171 (GRCm39) E366G probably damaging Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53,819,033 (GRCm39) missense probably benign 0.24
IGL01774:Cep120 APN 18 53,839,902 (GRCm39) missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53,847,839 (GRCm39) missense probably benign 0.01
IGL01906:Cep120 APN 18 53,847,984 (GRCm39) missense probably benign
IGL01941:Cep120 APN 18 53,856,220 (GRCm39) missense probably benign 0.00
IGL02952:Cep120 APN 18 53,816,300 (GRCm39) utr 3 prime probably benign
IGL03248:Cep120 APN 18 53,868,844 (GRCm39) missense probably benign 0.04
IGL03379:Cep120 APN 18 53,842,208 (GRCm39) missense probably benign
R0019:Cep120 UTSW 18 53,842,119 (GRCm39) splice site probably benign
R0039:Cep120 UTSW 18 53,819,033 (GRCm39) missense probably benign 0.24
R0763:Cep120 UTSW 18 53,854,809 (GRCm39) missense probably benign 0.00
R1015:Cep120 UTSW 18 53,836,193 (GRCm39) critical splice donor site probably null
R1340:Cep120 UTSW 18 53,857,463 (GRCm39) missense probably damaging 1.00
R1507:Cep120 UTSW 18 53,830,729 (GRCm39) missense probably damaging 0.99
R1649:Cep120 UTSW 18 53,857,648 (GRCm39) missense probably damaging 1.00
R1727:Cep120 UTSW 18 53,860,801 (GRCm39) missense probably benign 0.01
R1739:Cep120 UTSW 18 53,852,286 (GRCm39) critical splice donor site probably null
R1873:Cep120 UTSW 18 53,871,560 (GRCm39) missense probably damaging 0.98
R1913:Cep120 UTSW 18 53,856,358 (GRCm39) missense probably benign 0.26
R1968:Cep120 UTSW 18 53,856,313 (GRCm39) missense probably benign 0.42
R1995:Cep120 UTSW 18 53,873,208 (GRCm39) missense probably damaging 1.00
R2042:Cep120 UTSW 18 53,868,814 (GRCm39) missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53,852,384 (GRCm39) missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53,873,208 (GRCm39) missense probably damaging 1.00
R2215:Cep120 UTSW 18 53,860,707 (GRCm39) missense probably damaging 1.00
R2697:Cep120 UTSW 18 53,873,197 (GRCm39) missense probably benign 0.00
R3813:Cep120 UTSW 18 53,873,284 (GRCm39) splice site probably benign
R4012:Cep120 UTSW 18 53,871,654 (GRCm39) missense probably damaging 0.99
R4368:Cep120 UTSW 18 53,818,957 (GRCm39) splice site probably null
R4615:Cep120 UTSW 18 53,847,913 (GRCm39) missense probably damaging 1.00
R4772:Cep120 UTSW 18 53,851,561 (GRCm39) missense probably damaging 1.00
R4780:Cep120 UTSW 18 53,857,608 (GRCm39) missense probably benign 0.12
R5195:Cep120 UTSW 18 53,854,770 (GRCm39) missense probably damaging 1.00
R5991:Cep120 UTSW 18 53,854,870 (GRCm39) missense probably benign
R6156:Cep120 UTSW 18 53,836,295 (GRCm39) missense probably benign 0.00
R6188:Cep120 UTSW 18 53,857,529 (GRCm39) missense probably benign 0.03
R6688:Cep120 UTSW 18 53,857,608 (GRCm39) missense probably benign 0.12
R7143:Cep120 UTSW 18 53,816,457 (GRCm39) missense probably benign 0.00
R7282:Cep120 UTSW 18 53,873,161 (GRCm39) missense probably damaging 1.00
R7813:Cep120 UTSW 18 53,871,578 (GRCm39) missense probably damaging 1.00
R7818:Cep120 UTSW 18 53,856,175 (GRCm39) missense probably benign
R8677:Cep120 UTSW 18 53,871,633 (GRCm39) missense possibly damaging 0.90
R8724:Cep120 UTSW 18 53,856,199 (GRCm39) missense possibly damaging 0.88
R9164:Cep120 UTSW 18 53,852,318 (GRCm39) missense probably benign 0.02
R9225:Cep120 UTSW 18 53,839,896 (GRCm39) missense probably benign 0.00
R9300:Cep120 UTSW 18 53,852,369 (GRCm39) missense probably damaging 0.99
R9312:Cep120 UTSW 18 53,860,713 (GRCm39) missense probably benign 0.08
R9377:Cep120 UTSW 18 53,851,592 (GRCm39) missense possibly damaging 0.66
R9390:Cep120 UTSW 18 53,839,984 (GRCm39) nonsense probably null
R9499:Cep120 UTSW 18 53,819,033 (GRCm39) missense possibly damaging 0.94
R9551:Cep120 UTSW 18 53,819,033 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATTGGAGCAGAGTCCTGTG -3'
(R):5'- GCATTAAGCCGTTCAATCCTG -3'

Sequencing Primer
(F):5'- GCACACGTATTCATTAGTGGC -3'
(R):5'- CTGAATTCTTACTGGCCAC -3'
Posted On 2018-11-28