Mutagenetix > Incidental Mutation

Incidental Mutation 'R6961:Cep120'

541782

Institutional Source

Beutler Lab

Gene Symbol

Cep120

Ensembl Gene

ENSMUSG00000048799

Gene Name

centrosomal protein 120

Synonyms

Ccdc100

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.777) question?

Stock #

R6961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53681724-53744547 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 53703205 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 803 (E803*)

Ref Sequence

ENSEMBL: ENSMUSP00000062433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049811]

AlphaFold

Q7TSG1

Predicted Effect

probably null
Transcript: ENSMUST00000049811
AA Change: E803*

SMART Domains

Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: E803*

Domain	Start	End	E-Value	Type
Pfam:C2	9	114	4.8e-5	PFAM
Pfam:DUF3668	118	340	1e-96	PFAM
low complexity region	378	396	N/A	INTRINSIC
Pfam:C2	520	568	1.9e-3	PFAM
low complexity region	632	642	N/A	INTRINSIC
SCOP:d1eq1a_	661	803	2e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230113P08Rik	G	A	9: 35,908,444	M1I	probably null	Het
Aasdh	A	G	5: 76,876,301	L168P	probably damaging	Het
Atp6v0d1	A	G	8: 105,529,217	L173P	probably damaging	Het
Baiap2l2	A	G	15: 79,284,635	F23L	probably damaging	Het
Ccdc144b	T	A	3: 36,050,617	I32F	possibly damaging	Het
Cdh23	G	C	10: 60,650,114	L41V	probably benign	Het
Clcn7	C	T	17: 25,157,214	P560S	probably damaging	Het
Cldn12	A	T	5: 5,507,707	V240D	probably damaging	Het
Clec1a	C	T	6: 129,429,983	E190K	probably benign	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Crispld1	T	A	1: 17,762,141	H450Q	probably damaging	Het
Dsc2	A	T	18: 20,038,222	N573K	probably damaging	Het
Fam186a	T	A	15: 99,940,201	I2721F	probably benign	Het
Fbxl13	A	G	5: 21,543,742	F393S	probably damaging	Het
Fut1	A	T	7: 45,619,539	I306F	probably damaging	Het
Gas2l3	T	C	10: 89,413,291	D655G	probably benign	Het
Gm15448	T	C	7: 3,825,125	Y61C	probably damaging	Het
Gm29106	A	T	1: 118,200,398	K607*	probably null	Het
Gm609	T	A	16: 45,444,003	Y64F	probably benign	Het
Hmg20a	T	C	9: 56,488,728	V268A	probably benign	Het
Il2rb	T	A	15: 78,485,824	Y205F	probably damaging	Het
Ints4	A	G	7: 97,541,190	*965W	probably null	Het
Itsn2	T	A	12: 4,673,420	C1118*	probably null	Het
Jakmip1	T	C	5: 37,173,353	L459P	probably damaging	Het
Klhl8	T	C	5: 103,870,569	T323A	possibly damaging	Het
Mindy3	C	A	2: 12,396,178		probably null	Het
Myo3a	A	G	2: 22,245,558	T79A	probably benign	Het
Myom2	G	A	8: 15,117,741	A1109T	probably null	Het
Napa	C	T	7: 16,109,109	R53*	probably null	Het
Nudt21	A	C	8: 94,028,880	D133E	probably benign	Het
Olfr1220	T	A	2: 89,097,805	M41L	probably benign	Het
Olfr131	T	A	17: 38,082,205	I258F	probably damaging	Het
Olfr601	A	G	7: 103,358,582	V204A	possibly damaging	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr690	A	T	7: 105,329,706	I162K	probably damaging	Het
Olfr789	T	C	10: 129,487,462	F151L	probably damaging	Het
Pla2g4e	G	T	2: 120,174,370		probably null	Het
Ptbp1	T	C	10: 79,859,277		probably null	Het
Scfd2	A	C	5: 74,519,541	V317G	possibly damaging	Het
Slc45a1	T	C	4: 150,629,653	M712V	probably damaging	Het
Smg7	A	T	1: 152,841,583	L919*	probably null	Het
Sspo	T	A	6: 48,463,877	S1758T	probably benign	Het
Tgfb2	A	T	1: 186,649,835	M165K	possibly damaging	Het
Tie1	C	T	4: 118,486,205	V154M	probably damaging	Het
Timm17a	A	G	1: 135,311,078		probably benign	Het
Tlr5	C	T	1: 182,973,511	R127*	probably null	Het
Ttc29	A	C	8: 78,276,916	I254L	possibly damaging	Het
Unc79	T	C	12: 103,112,915	S1780P	probably damaging	Het
Vmn2r106	A	T	17: 20,268,384	Y584*	probably null	Het
Zbtb24	A	G	10: 41,455,175	E366G	probably damaging	Het

Other mutations in Cep120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01544:Cep120	APN	18	53685961	missense	probably benign	0.24
IGL01774:Cep120	APN	18	53706830	missense	possibly damaging	0.92
IGL01862:Cep120	APN	18	53714767	missense	probably benign	0.01
IGL01906:Cep120	APN	18	53714912	missense	probably benign
IGL01941:Cep120	APN	18	53723148	missense	probably benign	0.00
IGL02952:Cep120	APN	18	53683228	utr 3 prime	probably benign
IGL03248:Cep120	APN	18	53735772	missense	probably benign	0.04
IGL03379:Cep120	APN	18	53709136	missense	probably benign
R0019:Cep120	UTSW	18	53709047	splice site	probably benign
R0039:Cep120	UTSW	18	53685961	missense	probably benign	0.24
R0763:Cep120	UTSW	18	53721737	missense	probably benign	0.00
R1015:Cep120	UTSW	18	53703121	critical splice donor site	probably null
R1340:Cep120	UTSW	18	53724391	missense	probably damaging	1.00
R1507:Cep120	UTSW	18	53697657	missense	probably damaging	0.99
R1649:Cep120	UTSW	18	53724576	missense	probably damaging	1.00
R1727:Cep120	UTSW	18	53727729	missense	probably benign	0.01
R1739:Cep120	UTSW	18	53719214	critical splice donor site	probably null
R1873:Cep120	UTSW	18	53738488	missense	probably damaging	0.98
R1913:Cep120	UTSW	18	53723286	missense	probably benign	0.26
R1968:Cep120	UTSW	18	53723241	missense	probably benign	0.42
R1995:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2042:Cep120	UTSW	18	53735742	missense	possibly damaging	0.50
R2074:Cep120	UTSW	18	53719312	missense	possibly damaging	0.83
R2116:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2215:Cep120	UTSW	18	53727635	missense	probably damaging	1.00
R2697:Cep120	UTSW	18	53740125	missense	probably benign	0.00
R3813:Cep120	UTSW	18	53740212	splice site	probably benign
R4012:Cep120	UTSW	18	53738582	missense	probably damaging	0.99
R4368:Cep120	UTSW	18	53685885	splice site	probably null
R4615:Cep120	UTSW	18	53714841	missense	probably damaging	1.00
R4772:Cep120	UTSW	18	53718489	missense	probably damaging	1.00
R4780:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R5195:Cep120	UTSW	18	53721698	missense	probably damaging	1.00
R5991:Cep120	UTSW	18	53721798	missense	probably benign
R6156:Cep120	UTSW	18	53703223	missense	probably benign	0.00
R6188:Cep120	UTSW	18	53724457	missense	probably benign	0.03
R6688:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R7143:Cep120	UTSW	18	53683385	missense	probably benign	0.00
R7282:Cep120	UTSW	18	53740089	missense	probably damaging	1.00
R7813:Cep120	UTSW	18	53738506	missense	probably damaging	1.00
R7818:Cep120	UTSW	18	53723103	missense	probably benign
R8677:Cep120	UTSW	18	53738561	missense	possibly damaging	0.90
R8724:Cep120	UTSW	18	53723127	missense	possibly damaging	0.88
R9164:Cep120	UTSW	18	53719246	missense	probably benign	0.02
R9225:Cep120	UTSW	18	53706824	missense	probably benign	0.00
R9300:Cep120	UTSW	18	53719297	missense	probably damaging	0.99
R9312:Cep120	UTSW	18	53727641	missense	probably benign	0.08
R9377:Cep120	UTSW	18	53718520	missense	possibly damaging	0.66
R9390:Cep120	UTSW	18	53706912	nonsense	probably null
R9499:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94
R9551:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CATTGGAGCAGAGTCCTGTG -3'
(R):5'- GCATTAAGCCGTTCAATCCTG -3'

Sequencing Primer
(F):5'- GCACACGTATTCATTAGTGGC -3'
(R):5'- CTGAATTCTTACTGGCCAC -3'

Posted On

2018-11-28