Incidental Mutation 'R6962:Ticrr'
ID 541814
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 045072-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R6962 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 79315645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 300 (S300A)
Ref Sequence ENSEMBL: ENSMUSP00000146155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: S300A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: S300A

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
AA Change: S300A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000206591
AA Change: S300A

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206622
AA Change: S300A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,949,150 (GRCm39) K1016E probably benign Het
Abca3 T C 17: 24,583,700 (GRCm39) F30L probably benign Het
Arhgap17 C T 7: 122,895,655 (GRCm39) G490R probably damaging Het
Arsg T A 11: 109,412,495 (GRCm39) L140H probably damaging Het
Bmp2k T A 5: 97,179,097 (GRCm39) C130* probably null Het
C4b T C 17: 34,951,140 (GRCm39) probably null Het
Cdk5r2 A G 1: 74,894,975 (GRCm39) Y240C probably damaging Het
Cntnap5b A G 1: 100,202,197 (GRCm39) E348G probably benign Het
Col27a1 A G 4: 63,237,738 (GRCm39) probably benign Het
Cubn G A 2: 13,352,840 (GRCm39) S1966F probably benign Het
Dnajc13 T C 9: 104,058,208 (GRCm39) Y1509C probably benign Het
Dpp4 A G 2: 62,203,174 (GRCm39) V265A probably benign Het
Dync2i1 A T 12: 116,175,398 (GRCm39) D926E probably damaging Het
Fbxl8 C A 8: 105,995,338 (GRCm39) N283K possibly damaging Het
Fev T A 1: 74,921,299 (GRCm39) Q122L probably benign Het
Fgd4 T A 16: 16,301,951 (GRCm39) probably null Het
Fnip2 A C 3: 79,396,610 (GRCm39) L439R probably damaging Het
Git1 C A 11: 77,395,469 (GRCm39) Q389K probably benign Het
Gm10509 C G 17: 21,909,833 (GRCm39) I53M possibly damaging Het
Gm5773 A T 3: 93,681,234 (GRCm39) H302L possibly damaging Het
Greb1l G T 18: 10,547,327 (GRCm39) R1515L probably damaging Het
Gsc2 T C 16: 17,732,902 (GRCm39) Y2C possibly damaging Het
H60b A G 10: 22,162,053 (GRCm39) N93D probably benign Het
Hgf G A 5: 16,820,752 (GRCm39) R633Q probably benign Het
Hmgb1 C T 5: 148,985,633 (GRCm39) probably benign Het
Hmmr T C 11: 40,598,242 (GRCm39) T657A probably damaging Het
Htt G T 5: 35,057,115 (GRCm39) probably null Het
Ift80 G A 3: 68,901,878 (GRCm39) probably benign Het
Kcnq5 G T 1: 21,576,017 (GRCm39) T229K probably damaging Het
Kcp C T 6: 29,482,839 (GRCm39) R1410Q probably benign Het
Klhl30 T G 1: 91,285,137 (GRCm39) V331G probably damaging Het
Lrit1 G C 14: 36,782,052 (GRCm39) V242L probably damaging Het
Lrrc37 G A 11: 103,505,126 (GRCm39) P105S possibly damaging Het
Macf1 C T 4: 123,334,515 (GRCm39) R2849Q probably benign Het
Mex3b T G 7: 82,518,473 (GRCm39) S263A probably benign Het
Mrgpre A G 7: 143,334,799 (GRCm39) S235P probably damaging Het
Myh14 A T 7: 44,307,363 (GRCm39) V226D probably benign Het
Myom2 G A 8: 15,167,741 (GRCm39) A1109T probably null Het
Nudt8 G T 19: 4,051,831 (GRCm39) L147F probably damaging Het
Or2aj5 T A 16: 19,424,672 (GRCm39) I249L probably benign Het
Or52e8 T A 7: 104,624,580 (GRCm39) N208I probably benign Het
Or5w17 A G 2: 87,584,071 (GRCm39) Y89H probably benign Het
Or6z7 A T 7: 6,484,008 (GRCm39) I49N probably benign Het
P4htm C A 9: 108,456,394 (GRCm39) A469S possibly damaging Het
Pld4 A T 12: 112,733,288 (GRCm39) H288L probably benign Het
Pnpla1 T A 17: 29,097,455 (GRCm39) I207N probably damaging Het
Ppcs T G 4: 119,279,375 (GRCm39) N59T probably damaging Het
Ppm1k A T 6: 57,492,645 (GRCm39) C214S probably damaging Het
Psg25 C T 7: 18,263,679 (GRCm39) G48E probably damaging Het
Rassf7 A G 7: 140,797,503 (GRCm39) T239A possibly damaging Het
Rgs3 G T 4: 62,618,952 (GRCm39) probably benign Het
Scaper T C 9: 55,767,055 (GRCm39) T465A probably benign Het
Slc4a7 G T 14: 14,746,021 (GRCm38) G405C probably damaging Het
Smpd3 T C 8: 106,991,851 (GRCm39) D234G probably benign Het
Spata31f1e T C 4: 42,793,323 (GRCm39) T270A probably damaging Het
Ssc4d A G 5: 135,991,775 (GRCm39) probably null Het
Sugct G T 13: 17,032,606 (GRCm39) probably null Het
Taok2 C A 7: 126,466,088 (GRCm39) probably null Het
Tbx20 A G 9: 24,681,036 (GRCm39) V152A probably damaging Het
Tbx4 A G 11: 85,781,085 (GRCm39) E66G probably benign Het
Thbs2 T C 17: 14,902,082 (GRCm39) E382G probably benign Het
Trim46 A G 3: 89,146,303 (GRCm39) L396P probably damaging Het
Trim56 A G 5: 137,141,501 (GRCm39) F672L probably damaging Het
Ttf2 A G 3: 100,858,453 (GRCm39) L712S probably damaging Het
Unc93b1 T G 19: 3,986,303 (GRCm39) D112E possibly damaging Het
Usp17lc T C 7: 103,068,118 (GRCm39) L471P probably benign Het
Vmn2r85 A G 10: 130,261,452 (GRCm39) I295T probably damaging Het
Vmn2r96 T G 17: 18,818,283 (GRCm39) I812S probably damaging Het
Wdr7 G A 18: 63,998,359 (GRCm39) C1102Y possibly damaging Het
Wnt9b G T 11: 103,624,515 (GRCm39) Q92K probably null Het
Zbtb26 A T 2: 37,326,106 (GRCm39) M310K possibly damaging Het
Zdhhc1 T C 8: 106,210,279 (GRCm39) H46R probably damaging Het
Zfp628 G T 7: 4,922,549 (GRCm39) R257L probably benign Het
Zfp747l1 A T 7: 126,983,487 (GRCm39) D538E possibly damaging Het
Zmat4 A G 8: 24,392,181 (GRCm39) T46A probably benign Het
Zmiz2 T A 11: 6,352,455 (GRCm39) W637R probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TACCATCTTGCCAGCTGAAAC -3'
(R):5'- TGCTAAAGAAACTGGAAGTATGCC -3'

Sequencing Primer
(F):5'- CATCTTGCCAGCTGAAACTTGGAG -3'
(R):5'- TCCAGAGGTCCTGAGTTCAAATC -3'
Posted On 2018-11-28