Incidental Mutation 'R6962:Usp17lc'
ID541816
Institutional Source Beutler Lab
Gene Symbol Usp17lc
Ensembl Gene ENSMUSG00000058976
Gene Nameubiquitin specific peptidase 17-like C
SynonymsDub2, Usp17l5, Dub2b, Dub-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6962 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103415072-103419880 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103418911 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 471 (L471P)
Ref Sequence ENSEMBL: ENSMUSP00000102505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079348] [ENSMUST00000106892]
Predicted Effect probably benign
Transcript: ENSMUST00000079348
AA Change: L471P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078323
Gene: ENSMUSG00000058976
AA Change: L471P

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.8e-54 PFAM
Pfam:UCH_1 51 327 3.5e-25 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106892
AA Change: L471P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102505
Gene: ENSMUSG00000058976
AA Change: L471P

DomainStartEndE-ValueType
Pfam:UCH 50 345 1.3e-60 PFAM
Pfam:UCH_1 51 327 5.5e-30 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 96% (74/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic elthality before implantation, failure to hatch from the zona pellucida, decreased cell proliferation and increased apoptosis. Mice heterozygous for this allele exhibit abnormal body, testis and thymus weight and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,949 K1016E probably benign Het
9130019O22Rik A T 7: 127,384,315 D538E possibly damaging Het
Abca3 T C 17: 24,364,726 F30L probably benign Het
Arhgap17 C T 7: 123,296,432 G490R probably damaging Het
Arsg T A 11: 109,521,669 L140H probably damaging Het
Bmp2k T A 5: 97,031,238 C130* probably null Het
C4b T C 17: 34,732,166 probably null Het
Cdk5r2 A G 1: 74,855,816 Y240C probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Col27a1 A G 4: 63,319,501 probably benign Het
Cubn G A 2: 13,348,029 S1966F probably benign Het
Dnajc13 T C 9: 104,181,009 Y1509C probably benign Het
Dpp4 A G 2: 62,372,830 V265A probably benign Het
Fbxl8 C A 8: 105,268,706 N283K possibly damaging Het
Fev T A 1: 74,882,140 Q122L probably benign Het
Fgd4 T A 16: 16,484,087 probably null Het
Fnip2 A C 3: 79,489,303 L439R probably damaging Het
Git1 C A 11: 77,504,643 Q389K probably benign Het
Gm10509 C G 17: 21,690,926 I53M possibly damaging Het
Gm12394 T C 4: 42,793,323 T270A probably damaging Het
Gm5773 A T 3: 93,773,927 H302L possibly damaging Het
Gm884 G A 11: 103,614,300 P105S possibly damaging Het
Greb1l G T 18: 10,547,327 R1515L probably damaging Het
Gsc2 T C 16: 17,915,038 Y2C possibly damaging Het
H60b A G 10: 22,286,154 N93D probably benign Het
Hgf G A 5: 16,615,754 R633Q probably benign Het
Hmgb1 C T 5: 149,048,823 probably benign Het
Hmmr T C 11: 40,707,415 T657A probably damaging Het
Htt G T 5: 34,899,771 probably null Het
Ift80 G A 3: 68,994,545 probably benign Het
Kcnq5 G T 1: 21,505,793 T229K probably damaging Het
Kcp C T 6: 29,482,840 R1410Q probably benign Het
Klhl30 T G 1: 91,357,415 V331G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Macf1 C T 4: 123,440,722 R2849Q probably benign Het
Mex3b T G 7: 82,869,265 S263A probably benign Het
Mrgpre A G 7: 143,781,062 S235P probably damaging Het
Myh14 A T 7: 44,657,939 V226D probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nudt8 G T 19: 4,001,831 L147F probably damaging Het
Olfr1141 A G 2: 87,753,727 Y89H probably benign Het
Olfr170 T A 16: 19,605,922 I249L probably benign Het
Olfr5 A T 7: 6,481,009 I49N probably benign Het
Olfr671 T A 7: 104,975,373 N208I probably benign Het
P4htm C A 9: 108,579,195 A469S possibly damaging Het
Pld4 A T 12: 112,766,854 H288L probably benign Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppcs T G 4: 119,422,178 N59T probably damaging Het
Ppm1k A T 6: 57,515,660 C214S probably damaging Het
Psg25 C T 7: 18,529,754 G48E probably damaging Het
Rassf7 A G 7: 141,217,590 T239A possibly damaging Het
Rgs3 G T 4: 62,700,715 probably benign Het
Scaper T C 9: 55,859,771 T465A probably benign Het
Slc4a7 G T 14: 14,746,021 G405C probably damaging Het
Smpd3 T C 8: 106,265,219 D234G probably benign Het
Ssc4d A G 5: 135,962,921 probably null Het
Sugct G T 13: 16,858,021 probably null Het
Taok2 C A 7: 126,866,916 probably null Het
Tbx20 A G 9: 24,769,740 V152A probably damaging Het
Tbx4 A G 11: 85,890,259 E66G probably benign Het
Thbs2 T C 17: 14,681,820 E382G probably benign Het
Ticrr T G 7: 79,665,897 S300A possibly damaging Het
Trim46 A G 3: 89,238,996 L396P probably damaging Het
Trim56 A G 5: 137,112,647 F672L probably damaging Het
Ttf2 A G 3: 100,951,137 L712S probably damaging Het
Unc93b1 T G 19: 3,936,303 D112E possibly damaging Het
Vmn2r85 A G 10: 130,425,583 I295T probably damaging Het
Vmn2r96 T G 17: 18,598,021 I812S probably damaging Het
Wdr60 A T 12: 116,211,778 D926E probably damaging Het
Wdr7 G A 18: 63,865,288 C1102Y possibly damaging Het
Wnt9b G T 11: 103,733,689 Q92K probably null Het
Zbtb26 A T 2: 37,436,094 M310K possibly damaging Het
Zdhhc1 T C 8: 105,483,647 H46R probably damaging Het
Zfp628 G T 7: 4,919,550 R257L probably benign Het
Zmat4 A G 8: 23,902,165 T46A probably benign Het
Zmiz2 T A 11: 6,402,455 W637R probably damaging Het
Other mutations in Usp17lc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Usp17lc APN 7 103418941 missense possibly damaging 0.74
IGL00499:Usp17lc APN 7 103418466 missense probably damaging 1.00
IGL00499:Usp17lc APN 7 103418465 missense probably damaging 1.00
IGL01446:Usp17lc APN 7 103418444 missense probably benign 0.00
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1584:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1754:Usp17lc UTSW 7 103418848 missense probably benign 0.01
R2987:Usp17lc UTSW 7 103418302 missense probably damaging 0.99
R3969:Usp17lc UTSW 7 103418419 missense probably damaging 1.00
R4661:Usp17lc UTSW 7 103418590 missense probably benign 0.00
R5118:Usp17lc UTSW 7 103418661 missense probably benign 0.05
R5413:Usp17lc UTSW 7 103418556 missense probably benign
R7412:Usp17lc UTSW 7 103418368 missense probably damaging 1.00
R7638:Usp17lc UTSW 7 103418499 missense probably damaging 1.00
R7748:Usp17lc UTSW 7 103418481 missense probably damaging 1.00
R8194:Usp17lc UTSW 7 103418200 missense probably benign 0.00
R8303:Usp17lc UTSW 7 103418182 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTGCTTCAGGAAAAGAACCAC -3'
(R):5'- GTGGGTGAGTGAACACTAGC -3'

Sequencing Primer
(F):5'- ACCACAAGAAAGCTGGGC -3'
(R):5'- AGAAGCCTCTGCCCTTGC -3'
Posted On2018-11-28