Incidental Mutation 'R6962:Taok2'
ID541819
Institutional Source Beutler Lab
Gene Symbol Taok2
Ensembl Gene ENSMUSG00000059981
Gene NameTAO kinase 2
SynonymsMAP3K17, TAO2, 1110033K02Rik, PSK1, TAO1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6962 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126865678-126884703 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to A at 126866916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037248] [ENSMUST00000071268] [ENSMUST00000117394] [ENSMUST00000132808] [ENSMUST00000206968] [ENSMUST00000214525]
Predicted Effect probably benign
Transcript: ENSMUST00000037248
SMART Domains Protein: ENSMUSP00000035535
Gene: ENSMUSG00000042606

DomainStartEndE-ValueType
low complexity region 96 113 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 229 244 N/A INTRINSIC
low complexity region 286 339 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 405 419 N/A INTRINSIC
internal_repeat_1 420 443 6.44e-5 PROSPERO
internal_repeat_1 440 463 6.44e-5 PROSPERO
CHZ 529 565 1.17e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000071268
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117394
SMART Domains Protein: ENSMUSP00000112963
Gene: ENSMUSG00000059981

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
transmembrane domain 962 984 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1017 1039 N/A INTRINSIC
transmembrane domain 1052 1074 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1197 1215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132808
SMART Domains Protein: ENSMUSP00000115145
Gene: ENSMUSG00000042606

DomainStartEndE-ValueType
low complexity region 36 53 N/A INTRINSIC
low complexity region 88 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206968
Predicted Effect probably null
Transcript: ENSMUST00000214525
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. Mice homozygous for a targeted allele exhibit resistance to the ataxic effect of alcohol, reduced blood ethanol content, increased alcohol consumption, impaired CPP for alcohol, and impaired habituation in an open field. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,949 K1016E probably benign Het
9130019O22Rik A T 7: 127,384,315 D538E possibly damaging Het
Abca3 T C 17: 24,364,726 F30L probably benign Het
Arhgap17 C T 7: 123,296,432 G490R probably damaging Het
Arsg T A 11: 109,521,669 L140H probably damaging Het
Bmp2k T A 5: 97,031,238 C130* probably null Het
C4b T C 17: 34,732,166 probably null Het
Cdk5r2 A G 1: 74,855,816 Y240C probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Col27a1 A G 4: 63,319,501 probably benign Het
Cubn G A 2: 13,348,029 S1966F probably benign Het
Dnajc13 T C 9: 104,181,009 Y1509C probably benign Het
Dpp4 A G 2: 62,372,830 V265A probably benign Het
Fbxl8 C A 8: 105,268,706 N283K possibly damaging Het
Fev T A 1: 74,882,140 Q122L probably benign Het
Fgd4 T A 16: 16,484,087 probably null Het
Fnip2 A C 3: 79,489,303 L439R probably damaging Het
Git1 C A 11: 77,504,643 Q389K probably benign Het
Gm10509 C G 17: 21,690,926 I53M possibly damaging Het
Gm12394 T C 4: 42,793,323 T270A probably damaging Het
Gm5773 A T 3: 93,773,927 H302L possibly damaging Het
Gm884 G A 11: 103,614,300 P105S possibly damaging Het
Greb1l G T 18: 10,547,327 R1515L probably damaging Het
Gsc2 T C 16: 17,915,038 Y2C possibly damaging Het
H60b A G 10: 22,286,154 N93D probably benign Het
Hgf G A 5: 16,615,754 R633Q probably benign Het
Hmgb1 C T 5: 149,048,823 probably benign Het
Hmmr T C 11: 40,707,415 T657A probably damaging Het
Htt G T 5: 34,899,771 probably null Het
Ift80 G A 3: 68,994,545 probably benign Het
Kcnq5 G T 1: 21,505,793 T229K probably damaging Het
Kcp C T 6: 29,482,840 R1410Q probably benign Het
Klhl30 T G 1: 91,357,415 V331G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Macf1 C T 4: 123,440,722 R2849Q probably benign Het
Mex3b T G 7: 82,869,265 S263A probably benign Het
Mrgpre A G 7: 143,781,062 S235P probably damaging Het
Myh14 A T 7: 44,657,939 V226D probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nudt8 G T 19: 4,001,831 L147F probably damaging Het
Olfr1141 A G 2: 87,753,727 Y89H probably benign Het
Olfr170 T A 16: 19,605,922 I249L probably benign Het
Olfr5 A T 7: 6,481,009 I49N probably benign Het
Olfr671 T A 7: 104,975,373 N208I probably benign Het
P4htm C A 9: 108,579,195 A469S possibly damaging Het
Pld4 A T 12: 112,766,854 H288L probably benign Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppcs T G 4: 119,422,178 N59T probably damaging Het
Ppm1k A T 6: 57,515,660 C214S probably damaging Het
Psg25 C T 7: 18,529,754 G48E probably damaging Het
Rassf7 A G 7: 141,217,590 T239A possibly damaging Het
Rgs3 G T 4: 62,700,715 probably benign Het
Scaper T C 9: 55,859,771 T465A probably benign Het
Slc4a7 G T 14: 14,746,021 G405C probably damaging Het
Smpd3 T C 8: 106,265,219 D234G probably benign Het
Ssc4d A G 5: 135,962,921 probably null Het
Sugct G T 13: 16,858,021 probably null Het
Tbx20 A G 9: 24,769,740 V152A probably damaging Het
Tbx4 A G 11: 85,890,259 E66G probably benign Het
Thbs2 T C 17: 14,681,820 E382G probably benign Het
Ticrr T G 7: 79,665,897 S300A possibly damaging Het
Trim46 A G 3: 89,238,996 L396P probably damaging Het
Trim56 A G 5: 137,112,647 F672L probably damaging Het
Ttf2 A G 3: 100,951,137 L712S probably damaging Het
Unc93b1 T G 19: 3,936,303 D112E possibly damaging Het
Usp17lc T C 7: 103,418,911 L471P probably benign Het
Vmn2r85 A G 10: 130,425,583 I295T probably damaging Het
Vmn2r96 T G 17: 18,598,021 I812S probably damaging Het
Wdr60 A T 12: 116,211,778 D926E probably damaging Het
Wdr7 G A 18: 63,865,288 C1102Y possibly damaging Het
Wnt9b G T 11: 103,733,689 Q92K probably null Het
Zbtb26 A T 2: 37,436,094 M310K possibly damaging Het
Zdhhc1 T C 8: 105,483,647 H46R probably damaging Het
Zfp628 G T 7: 4,919,550 R257L probably benign Het
Zmat4 A G 8: 23,902,165 T46A probably benign Het
Zmiz2 T A 11: 6,402,455 W637R probably damaging Het
Other mutations in Taok2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Taok2 APN 7 126872411 missense probably damaging 0.98
IGL01153:Taok2 APN 7 126871032 missense probably damaging 0.99
IGL02689:Taok2 APN 7 126876098 missense probably damaging 0.99
R0049:Taok2 UTSW 7 126866411 missense possibly damaging 0.92
R0601:Taok2 UTSW 7 126879433 missense probably damaging 1.00
R0976:Taok2 UTSW 7 126875151 missense possibly damaging 0.77
R1456:Taok2 UTSW 7 126880141 missense probably benign 0.09
R1643:Taok2 UTSW 7 126875938 unclassified probably benign
R2084:Taok2 UTSW 7 126870191 missense probably benign 0.04
R2212:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R2471:Taok2 UTSW 7 126875100 missense probably damaging 0.98
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3162:Taok2 UTSW 7 126875175 missense possibly damaging 0.85
R3412:Taok2 UTSW 7 126870858 missense possibly damaging 0.79
R4085:Taok2 UTSW 7 126874725 missense possibly damaging 0.90
R4440:Taok2 UTSW 7 126866521 missense possibly damaging 0.85
R4775:Taok2 UTSW 7 126870768 missense probably damaging 0.99
R4787:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4788:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4791:Taok2 UTSW 7 126868132 missense possibly damaging 0.85
R4927:Taok2 UTSW 7 126876041 missense probably damaging 1.00
R5651:Taok2 UTSW 7 126880283 missense probably damaging 1.00
R6371:Taok2 UTSW 7 126870147 missense probably damaging 1.00
R6408:Taok2 UTSW 7 126870992 missense probably benign
R6605:Taok2 UTSW 7 126878758 missense probably damaging 1.00
R6828:Taok2 UTSW 7 126871875 splice site probably null
R6863:Taok2 UTSW 7 126871937 missense probably damaging 0.99
R6967:Taok2 UTSW 7 126870392 missense probably damaging 0.98
R7127:Taok2 UTSW 7 126867154 missense possibly damaging 0.82
R7187:Taok2 UTSW 7 126872380 missense probably damaging 0.99
R7307:Taok2 UTSW 7 126866818 missense probably damaging 1.00
R7325:Taok2 UTSW 7 126871088 missense probably benign
R7429:Taok2 UTSW 7 126870677 missense possibly damaging 0.95
R7497:Taok2 UTSW 7 126874878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACCAGTTTGGAGGCCCTG -3'
(R):5'- CTTACCAGAGCAAGATCAAGATCCG -3'

Sequencing Primer
(F):5'- TCCAATGGGCCCCTGAAC -3'
(R):5'- GATCCGCACAGAGAGCCAG -3'
Posted On2018-11-28