Incidental Mutation 'R6962:Myom2'
ID541823
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6962 (G1)
Quality Score214.009
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15117741 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1109 (A1109T)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably null
Transcript: ENSMUST00000033842
AA Change: A1109T

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: A1109T

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Meta Mutation Damage Score 0.1147 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,949 K1016E probably benign Het
9130019O22Rik A T 7: 127,384,315 D538E possibly damaging Het
Abca3 T C 17: 24,364,726 F30L probably benign Het
Arhgap17 C T 7: 123,296,432 G490R probably damaging Het
Arsg T A 11: 109,521,669 L140H probably damaging Het
Bmp2k T A 5: 97,031,238 C130* probably null Het
C4b T C 17: 34,732,166 probably null Het
Cdk5r2 A G 1: 74,855,816 Y240C probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Col27a1 A G 4: 63,319,501 probably benign Het
Cubn G A 2: 13,348,029 S1966F probably benign Het
Dnajc13 T C 9: 104,181,009 Y1509C probably benign Het
Dpp4 A G 2: 62,372,830 V265A probably benign Het
Fbxl8 C A 8: 105,268,706 N283K possibly damaging Het
Fev T A 1: 74,882,140 Q122L probably benign Het
Fgd4 T A 16: 16,484,087 probably null Het
Fnip2 A C 3: 79,489,303 L439R probably damaging Het
Git1 C A 11: 77,504,643 Q389K probably benign Het
Gm10509 C G 17: 21,690,926 I53M possibly damaging Het
Gm12394 T C 4: 42,793,323 T270A probably damaging Het
Gm5773 A T 3: 93,773,927 H302L possibly damaging Het
Gm884 G A 11: 103,614,300 P105S possibly damaging Het
Greb1l G T 18: 10,547,327 R1515L probably damaging Het
Gsc2 T C 16: 17,915,038 Y2C possibly damaging Het
H60b A G 10: 22,286,154 N93D probably benign Het
Hgf G A 5: 16,615,754 R633Q probably benign Het
Hmgb1 C T 5: 149,048,823 probably benign Het
Hmmr T C 11: 40,707,415 T657A probably damaging Het
Htt G T 5: 34,899,771 probably null Het
Ift80 G A 3: 68,994,545 probably benign Het
Kcnq5 G T 1: 21,505,793 T229K probably damaging Het
Kcp C T 6: 29,482,840 R1410Q probably benign Het
Klhl30 T G 1: 91,357,415 V331G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Macf1 C T 4: 123,440,722 R2849Q probably benign Het
Mex3b T G 7: 82,869,265 S263A probably benign Het
Mrgpre A G 7: 143,781,062 S235P probably damaging Het
Myh14 A T 7: 44,657,939 V226D probably benign Het
Nudt8 G T 19: 4,001,831 L147F probably damaging Het
Olfr1141 A G 2: 87,753,727 Y89H probably benign Het
Olfr170 T A 16: 19,605,922 I249L probably benign Het
Olfr5 A T 7: 6,481,009 I49N probably benign Het
Olfr671 T A 7: 104,975,373 N208I probably benign Het
P4htm C A 9: 108,579,195 A469S possibly damaging Het
Pld4 A T 12: 112,766,854 H288L probably benign Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppcs T G 4: 119,422,178 N59T probably damaging Het
Ppm1k A T 6: 57,515,660 C214S probably damaging Het
Psg25 C T 7: 18,529,754 G48E probably damaging Het
Rassf7 A G 7: 141,217,590 T239A possibly damaging Het
Rgs3 G T 4: 62,700,715 probably benign Het
Scaper T C 9: 55,859,771 T465A probably benign Het
Slc4a7 G T 14: 14,746,021 G405C probably damaging Het
Smpd3 T C 8: 106,265,219 D234G probably benign Het
Ssc4d A G 5: 135,962,921 probably null Het
Sugct G T 13: 16,858,021 probably null Het
Taok2 C A 7: 126,866,916 probably null Het
Tbx20 A G 9: 24,769,740 V152A probably damaging Het
Tbx4 A G 11: 85,890,259 E66G probably benign Het
Thbs2 T C 17: 14,681,820 E382G probably benign Het
Ticrr T G 7: 79,665,897 S300A possibly damaging Het
Trim46 A G 3: 89,238,996 L396P probably damaging Het
Trim56 A G 5: 137,112,647 F672L probably damaging Het
Ttf2 A G 3: 100,951,137 L712S probably damaging Het
Unc93b1 T G 19: 3,936,303 D112E possibly damaging Het
Usp17lc T C 7: 103,418,911 L471P probably benign Het
Vmn2r85 A G 10: 130,425,583 I295T probably damaging Het
Vmn2r96 T G 17: 18,598,021 I812S probably damaging Het
Wdr60 A T 12: 116,211,778 D926E probably damaging Het
Wdr7 G A 18: 63,865,288 C1102Y possibly damaging Het
Wnt9b G T 11: 103,733,689 Q92K probably null Het
Zbtb26 A T 2: 37,436,094 M310K possibly damaging Het
Zdhhc1 T C 8: 105,483,647 H46R probably damaging Het
Zfp628 G T 7: 4,919,550 R257L probably benign Het
Zmat4 A G 8: 23,902,165 T46A probably benign Het
Zmiz2 T A 11: 6,402,455 W637R probably damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCAACTGCAGTATGGACACAG -3'
(R):5'- GGCCTGCTCAAGATACACTACC -3'

Sequencing Primer
(F):5'- CTGCAGTATGGACACAGAGTTTC -3'
(R):5'- TGTGTGTGTAAGCCACCAC -3'
Posted On2018-11-28