Mutagenetix > Incidental Mutations

Incidental Mutation 'R6962:Tbx20'

541828

Institutional Source

Beutler Lab

Gene Symbol

Tbx20

Ensembl Gene

ENSMUSG00000031965

Gene Name

T-box 20

Synonyms

Tbx12, 9430010M06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6962 (G1)

Quality Score

216.009

Status

Validated

Chromosome

Chromosomal Location

24718138-24774303 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24769740 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 152 (V152A)

Ref Sequence

ENSEMBL: ENSMUSP00000126318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052946] [ENSMUST00000166018]

Predicted Effect

probably damaging
Transcript: ENSMUST00000052946
AA Change: V152A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052591
Gene: ENSMUSG00000031965
AA Change: V152A

Domain	Start	End	E-Value	Type
low complexity region	68	78	N/A	INTRINSIC
low complexity region	81	95	N/A	INTRINSIC
TBOX	98	292	1.08e-122	SMART
low complexity region	339	353	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166018
AA Change: V152A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126318
Gene: ENSMUSG00000031965
AA Change: V152A

Domain	Start	End	E-Value	Type
low complexity region	68	78	N/A	INTRINSIC
low complexity region	81	95	N/A	INTRINSIC
TBOX	98	292	1.08e-122	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000215802

Meta Mutation Damage Score

0.6864

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

96% (74/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, impaired cardiac looping, a small hourglass shaped heart, and decreased cardiomyocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 82,064,949	K1016E	probably benign	Het
9130019O22Rik	A	T	7: 127,384,315	D538E	possibly damaging	Het
Abca3	T	C	17: 24,364,726	F30L	probably benign	Het
Arhgap17	C	T	7: 123,296,432	G490R	probably damaging	Het
Arsg	T	A	11: 109,521,669	L140H	probably damaging	Het
Bmp2k	T	A	5: 97,031,238	C130*	probably null	Het
C4b	T	C	17: 34,732,166		probably null	Het
Cdk5r2	A	G	1: 74,855,816	Y240C	probably damaging	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Col27a1	A	G	4: 63,319,501		probably benign	Het
Cubn	G	A	2: 13,348,029	S1966F	probably benign	Het
Dnajc13	T	C	9: 104,181,009	Y1509C	probably benign	Het
Dpp4	A	G	2: 62,372,830	V265A	probably benign	Het
Fbxl8	C	A	8: 105,268,706	N283K	possibly damaging	Het
Fev	T	A	1: 74,882,140	Q122L	probably benign	Het
Fgd4	T	A	16: 16,484,087		probably null	Het
Fnip2	A	C	3: 79,489,303	L439R	probably damaging	Het
Git1	C	A	11: 77,504,643	Q389K	probably benign	Het
Gm10509	C	G	17: 21,690,926	I53M	possibly damaging	Het
Gm12394	T	C	4: 42,793,323	T270A	probably damaging	Het
Gm5773	A	T	3: 93,773,927	H302L	possibly damaging	Het
Gm884	G	A	11: 103,614,300	P105S	possibly damaging	Het
Greb1l	G	T	18: 10,547,327	R1515L	probably damaging	Het
Gsc2	T	C	16: 17,915,038	Y2C	possibly damaging	Het
H60b	A	G	10: 22,286,154	N93D	probably benign	Het
Hgf	G	A	5: 16,615,754	R633Q	probably benign	Het
Hmgb1	C	T	5: 149,048,823		probably benign	Het
Hmmr	T	C	11: 40,707,415	T657A	probably damaging	Het
Htt	G	T	5: 34,899,771		probably null	Het
Ift80	G	A	3: 68,994,545		probably benign	Het
Kcnq5	G	T	1: 21,505,793	T229K	probably damaging	Het
Kcp	C	T	6: 29,482,840	R1410Q	probably benign	Het
Klhl30	T	G	1: 91,357,415	V331G	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Macf1	C	T	4: 123,440,722	R2849Q	probably benign	Het
Mex3b	T	G	7: 82,869,265	S263A	probably benign	Het
Mrgpre	A	G	7: 143,781,062	S235P	probably damaging	Het
Myh14	A	T	7: 44,657,939	V226D	probably benign	Het
Myom2	G	A	8: 15,117,741	A1109T	probably null	Het
Nudt8	G	T	19: 4,001,831	L147F	probably damaging	Het
Olfr1141	A	G	2: 87,753,727	Y89H	probably benign	Het
Olfr170	T	A	16: 19,605,922	I249L	probably benign	Het
Olfr5	A	T	7: 6,481,009	I49N	probably benign	Het
Olfr671	T	A	7: 104,975,373	N208I	probably benign	Het
P4htm	C	A	9: 108,579,195	A469S	possibly damaging	Het
Pld4	A	T	12: 112,766,854	H288L	probably benign	Het
Pnpla1	T	A	17: 28,878,481	I207N	probably damaging	Het
Ppcs	T	G	4: 119,422,178	N59T	probably damaging	Het
Ppm1k	A	T	6: 57,515,660	C214S	probably damaging	Het
Psg25	C	T	7: 18,529,754	G48E	probably damaging	Het
Rassf7	A	G	7: 141,217,590	T239A	possibly damaging	Het
Rgs3	G	T	4: 62,700,715		probably benign	Het
Scaper	T	C	9: 55,859,771	T465A	probably benign	Het
Slc4a7	G	T	14: 14,746,021	G405C	probably damaging	Het
Smpd3	T	C	8: 106,265,219	D234G	probably benign	Het
Ssc4d	A	G	5: 135,962,921		probably null	Het
Sugct	G	T	13: 16,858,021		probably null	Het
Taok2	C	A	7: 126,866,916		probably null	Het
Tbx4	A	G	11: 85,890,259	E66G	probably benign	Het
Thbs2	T	C	17: 14,681,820	E382G	probably benign	Het
Ticrr	T	G	7: 79,665,897	S300A	possibly damaging	Het
Trim46	A	G	3: 89,238,996	L396P	probably damaging	Het
Trim56	A	G	5: 137,112,647	F672L	probably damaging	Het
Ttf2	A	G	3: 100,951,137	L712S	probably damaging	Het
Unc93b1	T	G	19: 3,936,303	D112E	possibly damaging	Het
Usp17lc	T	C	7: 103,418,911	L471P	probably benign	Het
Vmn2r85	A	G	10: 130,425,583	I295T	probably damaging	Het
Vmn2r96	T	G	17: 18,598,021	I812S	probably damaging	Het
Wdr60	A	T	12: 116,211,778	D926E	probably damaging	Het
Wdr7	G	A	18: 63,865,288	C1102Y	possibly damaging	Het
Wnt9b	G	T	11: 103,733,689	Q92K	probably null	Het
Zbtb26	A	T	2: 37,436,094	M310K	possibly damaging	Het
Zdhhc1	T	C	8: 105,483,647	H46R	probably damaging	Het
Zfp628	G	T	7: 4,919,550	R257L	probably benign	Het
Zmat4	A	G	8: 23,902,165	T46A	probably benign	Het
Zmiz2	T	A	11: 6,402,455	W637R	probably damaging	Het

Other mutations in Tbx20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Tbx20	APN	9	24758748	missense	probably damaging	1.00
IGL00572:Tbx20	APN	9	24725688	missense	probably benign
IGL01016:Tbx20	APN	9	24750321	missense	probably damaging	1.00
IGL01317:Tbx20	APN	9	24769755	missense	probably damaging	1.00
IGL02643:Tbx20	APN	9	24773713	unclassified	probably benign
IGL02690:Tbx20	APN	9	24773737	missense	probably benign	0.27
BB006:Tbx20	UTSW	9	24725763	missense	possibly damaging	0.86
BB016:Tbx20	UTSW	9	24725763	missense	possibly damaging	0.86
R0853:Tbx20	UTSW	9	24725612	missense	probably benign	0.05
R0855:Tbx20	UTSW	9	24725612	missense	probably benign	0.05
R0856:Tbx20	UTSW	9	24725612	missense	probably benign	0.05
R1781:Tbx20	UTSW	9	24725499	missense	probably benign	0.00
R1840:Tbx20	UTSW	9	24725676	missense	probably benign	0.22
R1981:Tbx20	UTSW	9	24770913	missense	possibly damaging	0.85
R2063:Tbx20	UTSW	9	24769771	nonsense	probably null
R2357:Tbx20	UTSW	9	24769776	missense	possibly damaging	0.56
R4166:Tbx20	UTSW	9	24769744	missense	probably damaging	1.00
R4790:Tbx20	UTSW	9	24725714	missense	probably benign	0.34
R4904:Tbx20	UTSW	9	24758833	missense	probably damaging	0.98
R5436:Tbx20	UTSW	9	24769720	missense	probably damaging	1.00
R5799:Tbx20	UTSW	9	24725520	nonsense	probably null
R5898:Tbx20	UTSW	9	24758859	missense	probably damaging	1.00
R6914:Tbx20	UTSW	9	24725483	missense	probably benign	0.19
R7556:Tbx20	UTSW	9	24750277	splice site	probably null
R7731:Tbx20	UTSW	9	24770697	missense	probably damaging	1.00
R7741:Tbx20	UTSW	9	24740285	splice site	probably null
R7832:Tbx20	UTSW	9	24773812	missense	probably damaging	1.00
R7929:Tbx20	UTSW	9	24725763	missense	possibly damaging	0.86
R7982:Tbx20	UTSW	9	24773924	unclassified	probably benign
R8110:Tbx20	UTSW	9	24725525	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCAGAATCCGATGTTTTAAAAC -3'
(R):5'- AAAGTCGTGTCTCTGTGGGC -3'

Sequencing Primer
(F):5'- CAACTCGCTTAAAATTCCCTTAAATC -3'
(R):5'- CTGTGGGCACATCTTTCATAAAC -3'

Posted On

2018-11-28