Mutagenetix > Incidental Mutations

Incidental Mutation 'R6962:Dnajc13'

541830

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R6962 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104181009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1509 (Y1509C)

Ref Sequence

ENSEMBL: ENSMUSP00000035170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

AlphaFold

D4AFX7

Predicted Effect

probably benign
Transcript: ENSMUST00000035170
AA Change: Y1509C

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: Y1509C

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186788
AA Change: Y1514C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: Y1514C

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Meta Mutation Damage Score

0.3243

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

96% (74/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 82,064,949	K1016E	probably benign	Het
9130019O22Rik	A	T	7: 127,384,315	D538E	possibly damaging	Het
Abca3	T	C	17: 24,364,726	F30L	probably benign	Het
Arhgap17	C	T	7: 123,296,432	G490R	probably damaging	Het
Arsg	T	A	11: 109,521,669	L140H	probably damaging	Het
Bmp2k	T	A	5: 97,031,238	C130*	probably null	Het
C4b	T	C	17: 34,732,166		probably null	Het
Cdk5r2	A	G	1: 74,855,816	Y240C	probably damaging	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Col27a1	A	G	4: 63,319,501		probably benign	Het
Cubn	G	A	2: 13,348,029	S1966F	probably benign	Het
Dpp4	A	G	2: 62,372,830	V265A	probably benign	Het
Fbxl8	C	A	8: 105,268,706	N283K	possibly damaging	Het
Fev	T	A	1: 74,882,140	Q122L	probably benign	Het
Fgd4	T	A	16: 16,484,087		probably null	Het
Fnip2	A	C	3: 79,489,303	L439R	probably damaging	Het
Git1	C	A	11: 77,504,643	Q389K	probably benign	Het
Gm10509	C	G	17: 21,690,926	I53M	possibly damaging	Het
Gm12394	T	C	4: 42,793,323	T270A	probably damaging	Het
Gm5773	A	T	3: 93,773,927	H302L	possibly damaging	Het
Gm884	G	A	11: 103,614,300	P105S	possibly damaging	Het
Greb1l	G	T	18: 10,547,327	R1515L	probably damaging	Het
Gsc2	T	C	16: 17,915,038	Y2C	possibly damaging	Het
H60b	A	G	10: 22,286,154	N93D	probably benign	Het
Hgf	G	A	5: 16,615,754	R633Q	probably benign	Het
Hmgb1	C	T	5: 149,048,823		probably benign	Het
Hmmr	T	C	11: 40,707,415	T657A	probably damaging	Het
Htt	G	T	5: 34,899,771		probably null	Het
Ift80	G	A	3: 68,994,545		probably benign	Het
Kcnq5	G	T	1: 21,505,793	T229K	probably damaging	Het
Kcp	C	T	6: 29,482,840	R1410Q	probably benign	Het
Klhl30	T	G	1: 91,357,415	V331G	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Macf1	C	T	4: 123,440,722	R2849Q	probably benign	Het
Mex3b	T	G	7: 82,869,265	S263A	probably benign	Het
Mrgpre	A	G	7: 143,781,062	S235P	probably damaging	Het
Myh14	A	T	7: 44,657,939	V226D	probably benign	Het
Myom2	G	A	8: 15,117,741	A1109T	probably null	Het
Nudt8	G	T	19: 4,001,831	L147F	probably damaging	Het
Olfr1141	A	G	2: 87,753,727	Y89H	probably benign	Het
Olfr170	T	A	16: 19,605,922	I249L	probably benign	Het
Olfr5	A	T	7: 6,481,009	I49N	probably benign	Het
Olfr671	T	A	7: 104,975,373	N208I	probably benign	Het
P4htm	C	A	9: 108,579,195	A469S	possibly damaging	Het
Pld4	A	T	12: 112,766,854	H288L	probably benign	Het
Pnpla1	T	A	17: 28,878,481	I207N	probably damaging	Het
Ppcs	T	G	4: 119,422,178	N59T	probably damaging	Het
Ppm1k	A	T	6: 57,515,660	C214S	probably damaging	Het
Psg25	C	T	7: 18,529,754	G48E	probably damaging	Het
Rassf7	A	G	7: 141,217,590	T239A	possibly damaging	Het
Rgs3	G	T	4: 62,700,715		probably benign	Het
Scaper	T	C	9: 55,859,771	T465A	probably benign	Het
Slc4a7	G	T	14: 14,746,021	G405C	probably damaging	Het
Smpd3	T	C	8: 106,265,219	D234G	probably benign	Het
Ssc4d	A	G	5: 135,962,921		probably null	Het
Sugct	G	T	13: 16,858,021		probably null	Het
Taok2	C	A	7: 126,866,916		probably null	Het
Tbx20	A	G	9: 24,769,740	V152A	probably damaging	Het
Tbx4	A	G	11: 85,890,259	E66G	probably benign	Het
Thbs2	T	C	17: 14,681,820	E382G	probably benign	Het
Ticrr	T	G	7: 79,665,897	S300A	possibly damaging	Het
Trim46	A	G	3: 89,238,996	L396P	probably damaging	Het
Trim56	A	G	5: 137,112,647	F672L	probably damaging	Het
Ttf2	A	G	3: 100,951,137	L712S	probably damaging	Het
Unc93b1	T	G	19: 3,936,303	D112E	possibly damaging	Het
Usp17lc	T	C	7: 103,418,911	L471P	probably benign	Het
Vmn2r85	A	G	10: 130,425,583	I295T	probably damaging	Het
Vmn2r96	T	G	17: 18,598,021	I812S	probably damaging	Het
Wdr60	A	T	12: 116,211,778	D926E	probably damaging	Het
Wdr7	G	A	18: 63,865,288	C1102Y	possibly damaging	Het
Wnt9b	G	T	11: 103,733,689	Q92K	probably null	Het
Zbtb26	A	T	2: 37,436,094	M310K	possibly damaging	Het
Zdhhc1	T	C	8: 105,483,647	H46R	probably damaging	Het
Zfp628	G	T	7: 4,919,550	R257L	probably benign	Het
Zmat4	A	G	8: 23,902,165	T46A	probably benign	Het
Zmiz2	T	A	11: 6,402,455	W637R	probably damaging	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
impressario	UTSW	9	104213886	missense	probably benign	0.12
Kaiser	UTSW	9	104214188	missense	probably damaging	1.00
BB008:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
BB018:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
R7856:Dnajc13	UTSW	9	104167485	missense	possibly damaging	0.83
R7931:Dnajc13	UTSW	9	104218564	missense	probably benign	0.02
R7995:Dnajc13	UTSW	9	104174363	missense	probably damaging	1.00
R8319:Dnajc13	UTSW	9	104190391	missense	probably benign	0.00
R8354:Dnajc13	UTSW	9	104217728	missense	probably damaging	1.00
R8680:Dnajc13	UTSW	9	104180139	missense	probably benign
R8686:Dnajc13	UTSW	9	104170805	missense	probably benign	0.00
R8707:Dnajc13	UTSW	9	104192648	missense	probably damaging	0.96
R8847:Dnajc13	UTSW	9	104180161	nonsense	probably null
R8868:Dnajc13	UTSW	9	104165788	missense	probably benign	0.13
R8986:Dnajc13	UTSW	9	104180131	missense	probably damaging	1.00
R9139:Dnajc13	UTSW	9	104207840	missense	probably benign	0.02
R9334:Dnajc13	UTSW	9	104174460	missense	probably benign	0.00
R9353:Dnajc13	UTSW	9	104190372	missense	probably benign	0.31
R9470:Dnajc13	UTSW	9	104230720	missense	probably benign	0.01
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGTGTGCCAGGATAGGAAC -3'
(R):5'- ATTAAGCATCGTCTCCCATCTG -3'

Sequencing Primer
(F):5'- GGATAGGAACAAACCCGATCATGTAC -3'
(R):5'- TCCCATCTGTGCTGATGTG -3'

Posted On

2018-11-28