Mutagenetix > Incidental Mutations

Incidental Mutation 'R6962:Arsg'

541840

Institutional Source

Beutler Lab

Gene Symbol

Arsg

Ensembl Gene

ENSMUSG00000020604

Gene Name

arylsulfatase G

Synonyms

6330406P08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6962 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

109473374-109573330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109521669 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 140 (L140H)

Ref Sequence

ENSEMBL: ENSMUSP00000102308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020928] [ENSMUST00000106697]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020928
AA Change: L140H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020928
Gene: ENSMUSG00000020604
AA Change: L140H

Domain	Start	End	E-Value	Type
Pfam:Sulfatase	36	378	2e-69	PFAM
Pfam:Sulfatase_C	401	522	2.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106697
AA Change: L140H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102308
Gene: ENSMUSG00000020604
AA Change: L140H

Domain	Start	End	E-Value	Type
Pfam:Sulfatase	36	378	2e-69	PFAM
Pfam:Sulfatase_C	401	522	4.7e-25	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

96% (74/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null mutation display lysosomal storage pathology in the nervous system and peripheral tissues, including the liver and kidneys, resulting in Purkinje cell loss and age dependent cognitive impairment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 82,064,949	K1016E	probably benign	Het
9130019O22Rik	A	T	7: 127,384,315	D538E	possibly damaging	Het
Abca3	T	C	17: 24,364,726	F30L	probably benign	Het
Arhgap17	C	T	7: 123,296,432	G490R	probably damaging	Het
Bmp2k	T	A	5: 97,031,238	C130*	probably null	Het
C4b	T	C	17: 34,732,166		probably null	Het
Cdk5r2	A	G	1: 74,855,816	Y240C	probably damaging	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Col27a1	A	G	4: 63,319,501		probably benign	Het
Cubn	G	A	2: 13,348,029	S1966F	probably benign	Het
Dnajc13	T	C	9: 104,181,009	Y1509C	probably benign	Het
Dpp4	A	G	2: 62,372,830	V265A	probably benign	Het
Fbxl8	C	A	8: 105,268,706	N283K	possibly damaging	Het
Fev	T	A	1: 74,882,140	Q122L	probably benign	Het
Fgd4	T	A	16: 16,484,087		probably null	Het
Fnip2	A	C	3: 79,489,303	L439R	probably damaging	Het
Git1	C	A	11: 77,504,643	Q389K	probably benign	Het
Gm10509	C	G	17: 21,690,926	I53M	possibly damaging	Het
Gm12394	T	C	4: 42,793,323	T270A	probably damaging	Het
Gm5773	A	T	3: 93,773,927	H302L	possibly damaging	Het
Gm884	G	A	11: 103,614,300	P105S	possibly damaging	Het
Greb1l	G	T	18: 10,547,327	R1515L	probably damaging	Het
Gsc2	T	C	16: 17,915,038	Y2C	possibly damaging	Het
H60b	A	G	10: 22,286,154	N93D	probably benign	Het
Hgf	G	A	5: 16,615,754	R633Q	probably benign	Het
Hmgb1	C	T	5: 149,048,823		probably benign	Het
Hmmr	T	C	11: 40,707,415	T657A	probably damaging	Het
Htt	G	T	5: 34,899,771		probably null	Het
Ift80	G	A	3: 68,994,545		probably benign	Het
Kcnq5	G	T	1: 21,505,793	T229K	probably damaging	Het
Kcp	C	T	6: 29,482,840	R1410Q	probably benign	Het
Klhl30	T	G	1: 91,357,415	V331G	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Macf1	C	T	4: 123,440,722	R2849Q	probably benign	Het
Mex3b	T	G	7: 82,869,265	S263A	probably benign	Het
Mrgpre	A	G	7: 143,781,062	S235P	probably damaging	Het
Myh14	A	T	7: 44,657,939	V226D	probably benign	Het
Myom2	G	A	8: 15,117,741	A1109T	probably null	Het
Nudt8	G	T	19: 4,001,831	L147F	probably damaging	Het
Olfr1141	A	G	2: 87,753,727	Y89H	probably benign	Het
Olfr170	T	A	16: 19,605,922	I249L	probably benign	Het
Olfr5	A	T	7: 6,481,009	I49N	probably benign	Het
Olfr671	T	A	7: 104,975,373	N208I	probably benign	Het
P4htm	C	A	9: 108,579,195	A469S	possibly damaging	Het
Pld4	A	T	12: 112,766,854	H288L	probably benign	Het
Pnpla1	T	A	17: 28,878,481	I207N	probably damaging	Het
Ppcs	T	G	4: 119,422,178	N59T	probably damaging	Het
Ppm1k	A	T	6: 57,515,660	C214S	probably damaging	Het
Psg25	C	T	7: 18,529,754	G48E	probably damaging	Het
Rassf7	A	G	7: 141,217,590	T239A	possibly damaging	Het
Rgs3	G	T	4: 62,700,715		probably benign	Het
Scaper	T	C	9: 55,859,771	T465A	probably benign	Het
Slc4a7	G	T	14: 14,746,021	G405C	probably damaging	Het
Smpd3	T	C	8: 106,265,219	D234G	probably benign	Het
Ssc4d	A	G	5: 135,962,921		probably null	Het
Sugct	G	T	13: 16,858,021		probably null	Het
Taok2	C	A	7: 126,866,916		probably null	Het
Tbx20	A	G	9: 24,769,740	V152A	probably damaging	Het
Tbx4	A	G	11: 85,890,259	E66G	probably benign	Het
Thbs2	T	C	17: 14,681,820	E382G	probably benign	Het
Ticrr	T	G	7: 79,665,897	S300A	possibly damaging	Het
Trim46	A	G	3: 89,238,996	L396P	probably damaging	Het
Trim56	A	G	5: 137,112,647	F672L	probably damaging	Het
Ttf2	A	G	3: 100,951,137	L712S	probably damaging	Het
Unc93b1	T	G	19: 3,936,303	D112E	possibly damaging	Het
Usp17lc	T	C	7: 103,418,911	L471P	probably benign	Het
Vmn2r85	A	G	10: 130,425,583	I295T	probably damaging	Het
Vmn2r96	T	G	17: 18,598,021	I812S	probably damaging	Het
Wdr60	A	T	12: 116,211,778	D926E	probably damaging	Het
Wdr7	G	A	18: 63,865,288	C1102Y	possibly damaging	Het
Wnt9b	G	T	11: 103,733,689	Q92K	probably null	Het
Zbtb26	A	T	2: 37,436,094	M310K	possibly damaging	Het
Zdhhc1	T	C	8: 105,483,647	H46R	probably damaging	Het
Zfp628	G	T	7: 4,919,550	R257L	probably benign	Het
Zmat4	A	G	8: 23,902,165	T46A	probably benign	Het
Zmiz2	T	A	11: 6,402,455	W637R	probably damaging	Het

Other mutations in Arsg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02093:Arsg	APN	11	109525446	missense	possibly damaging	0.88
IGL02257:Arsg	APN	11	109521647	splice site	probably benign
IGL03069:Arsg	APN	11	109563256	missense	probably damaging	1.00
R0421:Arsg	UTSW	11	109527766	missense	probably damaging	1.00
R1235:Arsg	UTSW	11	109534107	critical splice donor site	probably null
R1830:Arsg	UTSW	11	109563274	critical splice donor site	probably null
R2831:Arsg	UTSW	11	109525449	missense	possibly damaging	0.61
R4573:Arsg	UTSW	11	109517282	missense	probably damaging	1.00
R4780:Arsg	UTSW	11	109534013	missense	possibly damaging	0.80
R4811:Arsg	UTSW	11	109534072	missense	probably benign	0.00
R5510:Arsg	UTSW	11	109527874	missense	probably benign	0.33
R5861:Arsg	UTSW	11	109563188	missense	probably damaging	1.00
R5944:Arsg	UTSW	11	109535311	missense	probably damaging	0.99
R6502:Arsg	UTSW	11	109517336	missense	probably damaging	1.00
X0019:Arsg	UTSW	11	109563253	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTGAGTCATCCAGTTCCAG -3'
(R):5'- CACATGTTCCTACGTGACTTTGG -3'

Sequencing Primer
(F):5'- ATTCCTTGGGGTCTCAGAGAGC -3'
(R):5'- CTTTGGAAGTAAAGATGCCCTGAC -3'

Posted On

2018-11-28