Incidental Mutation 'R6962:Thbs2'
ID541848
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6962 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14681820 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 382 (E382G)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably benign
Transcript: ENSMUST00000170872
AA Change: E382G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: E382G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,949 K1016E probably benign Het
9130019O22Rik A T 7: 127,384,315 D538E possibly damaging Het
Abca3 T C 17: 24,364,726 F30L probably benign Het
Arhgap17 C T 7: 123,296,432 G490R probably damaging Het
Arsg T A 11: 109,521,669 L140H probably damaging Het
Bmp2k T A 5: 97,031,238 C130* probably null Het
C4b T C 17: 34,732,166 probably null Het
Cdk5r2 A G 1: 74,855,816 Y240C probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Col27a1 A G 4: 63,319,501 probably benign Het
Cubn G A 2: 13,348,029 S1966F probably benign Het
Dnajc13 T C 9: 104,181,009 Y1509C probably benign Het
Dpp4 A G 2: 62,372,830 V265A probably benign Het
Fbxl8 C A 8: 105,268,706 N283K possibly damaging Het
Fev T A 1: 74,882,140 Q122L probably benign Het
Fgd4 T A 16: 16,484,087 probably null Het
Fnip2 A C 3: 79,489,303 L439R probably damaging Het
Git1 C A 11: 77,504,643 Q389K probably benign Het
Gm10509 C G 17: 21,690,926 I53M possibly damaging Het
Gm12394 T C 4: 42,793,323 T270A probably damaging Het
Gm5773 A T 3: 93,773,927 H302L possibly damaging Het
Gm884 G A 11: 103,614,300 P105S possibly damaging Het
Greb1l G T 18: 10,547,327 R1515L probably damaging Het
Gsc2 T C 16: 17,915,038 Y2C possibly damaging Het
H60b A G 10: 22,286,154 N93D probably benign Het
Hgf G A 5: 16,615,754 R633Q probably benign Het
Hmgb1 C T 5: 149,048,823 probably benign Het
Hmmr T C 11: 40,707,415 T657A probably damaging Het
Htt G T 5: 34,899,771 probably null Het
Ift80 G A 3: 68,994,545 probably benign Het
Kcnq5 G T 1: 21,505,793 T229K probably damaging Het
Kcp C T 6: 29,482,840 R1410Q probably benign Het
Klhl30 T G 1: 91,357,415 V331G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Macf1 C T 4: 123,440,722 R2849Q probably benign Het
Mex3b T G 7: 82,869,265 S263A probably benign Het
Mrgpre A G 7: 143,781,062 S235P probably damaging Het
Myh14 A T 7: 44,657,939 V226D probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nudt8 G T 19: 4,001,831 L147F probably damaging Het
Olfr1141 A G 2: 87,753,727 Y89H probably benign Het
Olfr170 T A 16: 19,605,922 I249L probably benign Het
Olfr5 A T 7: 6,481,009 I49N probably benign Het
Olfr671 T A 7: 104,975,373 N208I probably benign Het
P4htm C A 9: 108,579,195 A469S possibly damaging Het
Pld4 A T 12: 112,766,854 H288L probably benign Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppcs T G 4: 119,422,178 N59T probably damaging Het
Ppm1k A T 6: 57,515,660 C214S probably damaging Het
Psg25 C T 7: 18,529,754 G48E probably damaging Het
Rassf7 A G 7: 141,217,590 T239A possibly damaging Het
Rgs3 G T 4: 62,700,715 probably benign Het
Scaper T C 9: 55,859,771 T465A probably benign Het
Slc4a7 G T 14: 14,746,021 G405C probably damaging Het
Smpd3 T C 8: 106,265,219 D234G probably benign Het
Ssc4d A G 5: 135,962,921 probably null Het
Sugct G T 13: 16,858,021 probably null Het
Taok2 C A 7: 126,866,916 probably null Het
Tbx20 A G 9: 24,769,740 V152A probably damaging Het
Tbx4 A G 11: 85,890,259 E66G probably benign Het
Ticrr T G 7: 79,665,897 S300A possibly damaging Het
Trim46 A G 3: 89,238,996 L396P probably damaging Het
Trim56 A G 5: 137,112,647 F672L probably damaging Het
Ttf2 A G 3: 100,951,137 L712S probably damaging Het
Unc93b1 T G 19: 3,936,303 D112E possibly damaging Het
Usp17lc T C 7: 103,418,911 L471P probably benign Het
Vmn2r85 A G 10: 130,425,583 I295T probably damaging Het
Vmn2r96 T G 17: 18,598,021 I812S probably damaging Het
Wdr60 A T 12: 116,211,778 D926E probably damaging Het
Wdr7 G A 18: 63,865,288 C1102Y possibly damaging Het
Wnt9b G T 11: 103,733,689 Q92K probably null Het
Zbtb26 A T 2: 37,436,094 M310K possibly damaging Het
Zdhhc1 T C 8: 105,483,647 H46R probably damaging Het
Zfp628 G T 7: 4,919,550 R257L probably benign Het
Zmat4 A G 8: 23,902,165 T46A probably benign Het
Zmiz2 T A 11: 6,402,455 W637R probably damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
R7386:Thbs2 UTSW 17 14673150 missense possibly damaging 0.95
R7621:Thbs2 UTSW 17 14674164 missense probably benign
R7747:Thbs2 UTSW 17 14670039 missense possibly damaging 0.94
R7759:Thbs2 UTSW 17 14677059 missense probably damaging 1.00
R7800:Thbs2 UTSW 17 14676296 missense probably damaging 1.00
R7895:Thbs2 UTSW 17 14676221 missense probably damaging 1.00
R8094:Thbs2 UTSW 17 14680322 missense probably benign 0.00
R8332:Thbs2 UTSW 17 14679770 missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTGTTGGCATACCCACATG -3'
(R):5'- TGAAGACACTTAAGCTTGCCCAG -3'

Sequencing Primer
(F):5'- GTTGGCATACCCACATGAGGAAC -3'
(R):5'- AAGCTTGCCCAGGTGGTG -3'
Posted On2018-11-28