Mutagenetix > Incidental Mutation

Incidental Mutation 'R6962:Greb1l'

541853

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

045072-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6962 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 10547327 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1515 (R1515L)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: R1515L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: R1515L

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

96% (74/77)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 82,064,949	K1016E	probably benign	Het
9130019O22Rik	A	T	7: 127,384,315	D538E	possibly damaging	Het
Abca3	T	C	17: 24,364,726	F30L	probably benign	Het
Arhgap17	C	T	7: 123,296,432	G490R	probably damaging	Het
Arsg	T	A	11: 109,521,669	L140H	probably damaging	Het
Bmp2k	T	A	5: 97,031,238	C130*	probably null	Het
C4b	T	C	17: 34,732,166		probably null	Het
Cdk5r2	A	G	1: 74,855,816	Y240C	probably damaging	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Col27a1	A	G	4: 63,319,501		probably benign	Het
Cubn	G	A	2: 13,348,029	S1966F	probably benign	Het
Dnajc13	T	C	9: 104,181,009	Y1509C	probably benign	Het
Dpp4	A	G	2: 62,372,830	V265A	probably benign	Het
Fbxl8	C	A	8: 105,268,706	N283K	possibly damaging	Het
Fev	T	A	1: 74,882,140	Q122L	probably benign	Het
Fgd4	T	A	16: 16,484,087		probably null	Het
Fnip2	A	C	3: 79,489,303	L439R	probably damaging	Het
Git1	C	A	11: 77,504,643	Q389K	probably benign	Het
Gm10509	C	G	17: 21,690,926	I53M	possibly damaging	Het
Gm12394	T	C	4: 42,793,323	T270A	probably damaging	Het
Gm5773	A	T	3: 93,773,927	H302L	possibly damaging	Het
Gm884	G	A	11: 103,614,300	P105S	possibly damaging	Het
Gsc2	T	C	16: 17,915,038	Y2C	possibly damaging	Het
H60b	A	G	10: 22,286,154	N93D	probably benign	Het
Hgf	G	A	5: 16,615,754	R633Q	probably benign	Het
Hmgb1	C	T	5: 149,048,823		probably benign	Het
Hmmr	T	C	11: 40,707,415	T657A	probably damaging	Het
Htt	G	T	5: 34,899,771		probably null	Het
Ift80	G	A	3: 68,994,545		probably benign	Het
Kcnq5	G	T	1: 21,505,793	T229K	probably damaging	Het
Kcp	C	T	6: 29,482,840	R1410Q	probably benign	Het
Klhl30	T	G	1: 91,357,415	V331G	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Macf1	C	T	4: 123,440,722	R2849Q	probably benign	Het
Mex3b	T	G	7: 82,869,265	S263A	probably benign	Het
Mrgpre	A	G	7: 143,781,062	S235P	probably damaging	Het
Myh14	A	T	7: 44,657,939	V226D	probably benign	Het
Myom2	G	A	8: 15,117,741	A1109T	probably null	Het
Nudt8	G	T	19: 4,001,831	L147F	probably damaging	Het
Olfr1141	A	G	2: 87,753,727	Y89H	probably benign	Het
Olfr170	T	A	16: 19,605,922	I249L	probably benign	Het
Olfr5	A	T	7: 6,481,009	I49N	probably benign	Het
Olfr671	T	A	7: 104,975,373	N208I	probably benign	Het
P4htm	C	A	9: 108,579,195	A469S	possibly damaging	Het
Pld4	A	T	12: 112,766,854	H288L	probably benign	Het
Pnpla1	T	A	17: 28,878,481	I207N	probably damaging	Het
Ppcs	T	G	4: 119,422,178	N59T	probably damaging	Het
Ppm1k	A	T	6: 57,515,660	C214S	probably damaging	Het
Psg25	C	T	7: 18,529,754	G48E	probably damaging	Het
Rassf7	A	G	7: 141,217,590	T239A	possibly damaging	Het
Rgs3	G	T	4: 62,700,715		probably benign	Het
Scaper	T	C	9: 55,859,771	T465A	probably benign	Het
Slc4a7	G	T	14: 14,746,021	G405C	probably damaging	Het
Smpd3	T	C	8: 106,265,219	D234G	probably benign	Het
Ssc4d	A	G	5: 135,962,921		probably null	Het
Sugct	G	T	13: 16,858,021		probably null	Het
Taok2	C	A	7: 126,866,916		probably null	Het
Tbx20	A	G	9: 24,769,740	V152A	probably damaging	Het
Tbx4	A	G	11: 85,890,259	E66G	probably benign	Het
Thbs2	T	C	17: 14,681,820	E382G	probably benign	Het
Ticrr	T	G	7: 79,665,897	S300A	possibly damaging	Het
Trim46	A	G	3: 89,238,996	L396P	probably damaging	Het
Trim56	A	G	5: 137,112,647	F672L	probably damaging	Het
Ttf2	A	G	3: 100,951,137	L712S	probably damaging	Het
Unc93b1	T	G	19: 3,936,303	D112E	possibly damaging	Het
Usp17lc	T	C	7: 103,418,911	L471P	probably benign	Het
Vmn2r85	A	G	10: 130,425,583	I295T	probably damaging	Het
Vmn2r96	T	G	17: 18,598,021	I812S	probably damaging	Het
Wdr60	A	T	12: 116,211,778	D926E	probably damaging	Het
Wdr7	G	A	18: 63,865,288	C1102Y	possibly damaging	Het
Wnt9b	G	T	11: 103,733,689	Q92K	probably null	Het
Zbtb26	A	T	2: 37,436,094	M310K	possibly damaging	Het
Zdhhc1	T	C	8: 105,483,647	H46R	probably damaging	Het
Zfp628	G	T	7: 4,919,550	R257L	probably benign	Het
Zmat4	A	G	8: 23,902,165	T46A	probably benign	Het
Zmiz2	T	A	11: 6,402,455	W637R	probably damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCATTTTGTCTTCAGCAAGCAG -3'
(R):5'- ACTCCAAGGGCACTCTTACC -3'

Sequencing Primer
(F):5'- TCTTCAGCAAGCAGGGCAGAC -3'
(R):5'- CCACGCCTGCATTATTAAACATG -3'

Posted On

2018-11-28