Incidental Mutation 'R6962:Unc93b1'
ID 541855
Institutional Source Beutler Lab
Gene Symbol Unc93b1
Ensembl Gene ENSMUSG00000036908
Gene Name unc-93 homolog B1 (C. elegans)
Synonyms unc-93 homolog B, unc-93 related protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6962 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 3935186-3949340 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3936303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 112 (D112E)
Ref Sequence ENSEMBL: ENSMUSP00000124272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162708] [ENSMUST00000165711]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000162708
AA Change: D112E

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124272
Gene: ENSMUSG00000036908
AA Change: D112E

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 1.6e-8 PFAM
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 306 328 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
transmembrane domain 494 513 N/A INTRINSIC
transmembrane domain 518 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165711
AA Change: D112E

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128751
Gene: ENSMUSG00000036908
AA Change: D112E

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 5.1e-9 PFAM
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in innate and adaptive immune response by regulating toll-like receptor signaling. The encoded protein traffics nucleotide sensing toll-like receptors to the endolysosome from the endoplasmic reticulum. Deficiency of the encoded protein has been associated with herpes simplex encephalitis. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice with a transmembrane domain point mutation have no overt phenotype but fail to mount a normal cytokine response and exhibit increased susceptibility to mouse cytomegalovirus, Lysteria monocytogenes and Staphlococcus aureus. Antigen presentation by MHC class I and II is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,949 K1016E probably benign Het
9130019O22Rik A T 7: 127,384,315 D538E possibly damaging Het
Abca3 T C 17: 24,364,726 F30L probably benign Het
Arhgap17 C T 7: 123,296,432 G490R probably damaging Het
Arsg T A 11: 109,521,669 L140H probably damaging Het
Bmp2k T A 5: 97,031,238 C130* probably null Het
C4b T C 17: 34,732,166 probably null Het
Cdk5r2 A G 1: 74,855,816 Y240C probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Col27a1 A G 4: 63,319,501 probably benign Het
Cubn G A 2: 13,348,029 S1966F probably benign Het
Dnajc13 T C 9: 104,181,009 Y1509C probably benign Het
Dpp4 A G 2: 62,372,830 V265A probably benign Het
Fbxl8 C A 8: 105,268,706 N283K possibly damaging Het
Fev T A 1: 74,882,140 Q122L probably benign Het
Fgd4 T A 16: 16,484,087 probably null Het
Fnip2 A C 3: 79,489,303 L439R probably damaging Het
Git1 C A 11: 77,504,643 Q389K probably benign Het
Gm10509 C G 17: 21,690,926 I53M possibly damaging Het
Gm12394 T C 4: 42,793,323 T270A probably damaging Het
Gm5773 A T 3: 93,773,927 H302L possibly damaging Het
Gm884 G A 11: 103,614,300 P105S possibly damaging Het
Greb1l G T 18: 10,547,327 R1515L probably damaging Het
Gsc2 T C 16: 17,915,038 Y2C possibly damaging Het
H60b A G 10: 22,286,154 N93D probably benign Het
Hgf G A 5: 16,615,754 R633Q probably benign Het
Hmgb1 C T 5: 149,048,823 probably benign Het
Hmmr T C 11: 40,707,415 T657A probably damaging Het
Htt G T 5: 34,899,771 probably null Het
Ift80 G A 3: 68,994,545 probably benign Het
Kcnq5 G T 1: 21,505,793 T229K probably damaging Het
Kcp C T 6: 29,482,840 R1410Q probably benign Het
Klhl30 T G 1: 91,357,415 V331G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Macf1 C T 4: 123,440,722 R2849Q probably benign Het
Mex3b T G 7: 82,869,265 S263A probably benign Het
Mrgpre A G 7: 143,781,062 S235P probably damaging Het
Myh14 A T 7: 44,657,939 V226D probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nudt8 G T 19: 4,001,831 L147F probably damaging Het
Olfr1141 A G 2: 87,753,727 Y89H probably benign Het
Olfr170 T A 16: 19,605,922 I249L probably benign Het
Olfr5 A T 7: 6,481,009 I49N probably benign Het
Olfr671 T A 7: 104,975,373 N208I probably benign Het
P4htm C A 9: 108,579,195 A469S possibly damaging Het
Pld4 A T 12: 112,766,854 H288L probably benign Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppcs T G 4: 119,422,178 N59T probably damaging Het
Ppm1k A T 6: 57,515,660 C214S probably damaging Het
Psg25 C T 7: 18,529,754 G48E probably damaging Het
Rassf7 A G 7: 141,217,590 T239A possibly damaging Het
Rgs3 G T 4: 62,700,715 probably benign Het
Scaper T C 9: 55,859,771 T465A probably benign Het
Slc4a7 G T 14: 14,746,021 G405C probably damaging Het
Smpd3 T C 8: 106,265,219 D234G probably benign Het
Ssc4d A G 5: 135,962,921 probably null Het
Sugct G T 13: 16,858,021 probably null Het
Taok2 C A 7: 126,866,916 probably null Het
Tbx20 A G 9: 24,769,740 V152A probably damaging Het
Tbx4 A G 11: 85,890,259 E66G probably benign Het
Thbs2 T C 17: 14,681,820 E382G probably benign Het
Ticrr T G 7: 79,665,897 S300A possibly damaging Het
Trim46 A G 3: 89,238,996 L396P probably damaging Het
Trim56 A G 5: 137,112,647 F672L probably damaging Het
Ttf2 A G 3: 100,951,137 L712S probably damaging Het
Usp17lc T C 7: 103,418,911 L471P probably benign Het
Vmn2r85 A G 10: 130,425,583 I295T probably damaging Het
Vmn2r96 T G 17: 18,598,021 I812S probably damaging Het
Wdr60 A T 12: 116,211,778 D926E probably damaging Het
Wdr7 G A 18: 63,865,288 C1102Y possibly damaging Het
Wnt9b G T 11: 103,733,689 Q92K probably null Het
Zbtb26 A T 2: 37,436,094 M310K possibly damaging Het
Zdhhc1 T C 8: 105,483,647 H46R probably damaging Het
Zfp628 G T 7: 4,919,550 R257L probably benign Het
Zmat4 A G 8: 23,902,165 T46A probably benign Het
Zmiz2 T A 11: 6,402,455 W637R probably damaging Het
Other mutations in Unc93b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Unc93b1 APN 19 3935356 splice site probably null
IGL02631:Unc93b1 APN 19 3942026 splice site probably benign
IGL02942:Unc93b1 APN 19 3948686 missense probably damaging 1.00
IGL03149:Unc93b1 APN 19 3944041 missense probably benign
3d UTSW 19 3944168 missense possibly damaging 0.96
novelty UTSW 19 3943632 missense probably damaging 1.00
speciality UTSW 19 3941910 missense possibly damaging 0.51
R0680:Unc93b1 UTSW 19 3947093 missense probably benign
R1237:Unc93b1 UTSW 19 3935228 missense possibly damaging 0.72
R1557:Unc93b1 UTSW 19 3942403 missense probably benign 0.13
R1992:Unc93b1 UTSW 19 3944062 missense probably benign 0.00
R2435:Unc93b1 UTSW 19 3936373 missense possibly damaging 0.89
R4016:Unc93b1 UTSW 19 3943572 missense probably damaging 1.00
R4080:Unc93b1 UTSW 19 3941959 missense probably damaging 0.99
R4479:Unc93b1 UTSW 19 3935236 missense probably benign 0.16
R4829:Unc93b1 UTSW 19 3944293 missense probably damaging 1.00
R4947:Unc93b1 UTSW 19 3935871 missense probably benign 0.05
R4964:Unc93b1 UTSW 19 3942023 splice site probably null
R4966:Unc93b1 UTSW 19 3942023 splice site probably null
R5056:Unc93b1 UTSW 19 3942762 missense possibly damaging 0.45
R5166:Unc93b1 UTSW 19 3944027 missense probably damaging 1.00
R5441:Unc93b1 UTSW 19 3943703 missense probably benign 0.01
R5892:Unc93b1 UTSW 19 3943632 missense probably damaging 1.00
R6382:Unc93b1 UTSW 19 3935297 missense probably benign 0.19
R6556:Unc93b1 UTSW 19 3944105 missense probably benign
R7143:Unc93b1 UTSW 19 3935204 missense unknown
R7748:Unc93b1 UTSW 19 3935250 missense unknown
R7866:Unc93b1 UTSW 19 3935243 missense not run
R8198:Unc93b1 UTSW 19 3941910 missense possibly damaging 0.51
R9212:Unc93b1 UTSW 19 3943557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGGGAGTCTTGTTCTTATCC -3'
(R):5'- GCCTCAGTCCAAAATAGGAGGG -3'

Sequencing Primer
(F):5'- ATCCTGGTCCTGATGAATACAG -3'
(R):5'- AGGTGGCCTTATGATCCAAC -3'
Posted On 2018-11-28