Mutagenetix > Incidental Mutation

Incidental Mutation 'R6964:Dock10'

541860

Institutional Source

Beutler Lab

Gene Symbol

Dock10

Ensembl Gene

ENSMUSG00000038608

Gene Name

dedicator of cytokinesis 10

Synonyms

Jr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3

MMRRC Submission

045074-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.456) question?

Stock #

R6964 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80501073-80758527 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 80503648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000077946

SMART Domains

Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
Pfam:DUF3398	61	153	1.7e-36	PFAM
PH	182	292	8.5e-17	SMART
Blast:PH	350	458	7e-18	BLAST
Pfam:DOCK-C2	668	859	1e-50	PFAM
low complexity region	1269	1279	N/A	INTRINSIC
low complexity region	1284	1295	N/A	INTRINSIC
Pfam:DHR-2	1592	2143	1.3e-216	PFAM
low complexity region	2174	2187	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187774

SMART Domains

Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608

Domain	Start	End	E-Value	Type
Pfam:DUF3398	46	141	9e-29	PFAM
PH	170	280	3.9e-19	SMART
Blast:PH	338	446	7e-18	BLAST
Pfam:DOCK-C2	655	848	1.5e-54	PFAM
low complexity region	1257	1267	N/A	INTRINSIC
low complexity region	1272	1283	N/A	INTRINSIC
low complexity region	1870	1890	N/A	INTRINSIC
Pfam:Ded_cyto	1954	2131	3.4e-65	PFAM
low complexity region	2162	2175	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190595

SMART Domains

Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608

Domain	Start	End	E-Value	Type
Blast:PH	3	111	5e-18	BLAST
Pfam:DOCK-C2	320	513	1.2e-54	PFAM
low complexity region	922	932	N/A	INTRINSIC
low complexity region	937	948	N/A	INTRINSIC
low complexity region	1508	1522	N/A	INTRINSIC
Pfam:Ded_cyto	1588	1765	2.7e-65	PFAM
low complexity region	1783	1795	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190983

SMART Domains

Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608

Domain	Start	End	E-Value	Type
Pfam:DUF3398	45	140	8.9e-29	PFAM
PH	169	279	3.9e-19	SMART
Blast:PH	337	445	7e-18	BLAST
Pfam:DOCK-C2	654	847	1.5e-54	PFAM
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1271	1282	N/A	INTRINSIC
low complexity region	1869	1889	N/A	INTRINSIC
Pfam:Ded_cyto	1953	2130	3.4e-65	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630089N07Rik	A	T	16: 98,065,759	Y334*	probably null	Het
Abcc2	A	C	19: 43,798,076	I116L	probably benign	Het
Adamts17	T	A	7: 66,909,400	Y313N	possibly damaging	Het
Adamts17	A	G	7: 67,004,353	T444A	probably benign	Het
Adamtsl1	A	G	4: 86,156,854	I153V	probably damaging	Het
Ambra1	C	T	2: 91,917,416	Q1046*	probably null	Het
Ap1g2	A	T	14: 55,099,265	V750D	possibly damaging	Het
Bcl7a	T	C	5: 123,369,456		probably null	Het
C4bp	A	T	1: 130,657,272	L9Q	probably damaging	Het
Cadps2	A	C	6: 23,583,459	V344G	probably damaging	Het
Car7	A	G	8: 104,543,581	D15G	possibly damaging	Het
Cep126	G	C	9: 8,112,100	H157Q	probably null	Het
Chst11	C	T	10: 83,191,381	T214I	probably damaging	Het
Cntrob	G	A	11: 69,309,491	R526*	probably null	Het
Cul1	A	G	6: 47,516,509	T445A	probably benign	Het
Dclre1c	T	C	2: 3,453,169	V363A	possibly damaging	Het
Ddx58	A	G	4: 40,225,697	S235P	probably benign	Het
Donson	A	G	16: 91,681,219	Y465H	probably benign	Het
Eif3e	G	A	15: 43,272,289	A118V	probably benign	Het
Fam47e	A	T	5: 92,566,052	Q180L	probably damaging	Het
Fat1	T	G	8: 45,043,945	C4156G	probably damaging	Het
Fermt2	A	T	14: 45,465,142	I441K	probably damaging	Het
Frmd4b	C	T	6: 97,305,197	R510Q	probably damaging	Het
Fscn1	C	T	5: 142,960,660	A71V	probably damaging	Het
Gfap	G	A	11: 102,896,957	A54V	possibly damaging	Het
Gjc3	C	T	5: 137,957,497	M175I	probably benign	Het
Gm10645	C	T	8: 83,165,952		probably benign	Het
Haus5	G	A	7: 30,657,615	P464S	probably benign	Het
Helz2	T	A	2: 181,230,428	I2584F	probably damaging	Het
Mak	T	A	13: 41,032,591	I534L	probably benign	Het
Map3k9	T	C	12: 81,773,003	D159G	probably benign	Het
Mcat	A	G	15: 83,547,931		probably benign	Het
Meltf	A	G	16: 31,880,162	D30G	probably benign	Het
Ntng2	T	A	2: 29,197,029	Y452F	probably benign	Het
Olfr1130	T	C	2: 87,607,613	L75P	probably damaging	Het
Olfr1245	T	A	2: 89,574,989	I246F	probably benign	Het
Olfr1474	T	A	19: 13,471,361	Y130*	probably null	Het
Olfr473	A	T	7: 107,933,759	I80L	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pianp	T	A	6: 124,999,390	V54D	possibly damaging	Het
Ptprn	T	C	1: 75,260,649	D103G	possibly damaging	Het
Rhcg	A	G	7: 79,600,531	V268A	probably benign	Het
Rhoj	T	A	12: 75,375,389	Y74N	probably damaging	Het
Snx13	A	C	12: 35,119,789	T578P	possibly damaging	Het
Star	T	A	8: 25,811,823	H227Q	probably benign	Het
Stau2	A	C	1: 16,390,005	M204R	probably damaging	Het
Steap4	A	G	5: 7,975,568	Y43C	probably damaging	Het
Syt8	A	G	7: 142,439,421	E21G	probably benign	Het
Tacr3	T	C	3: 134,829,739	V156A	probably damaging	Het
Tmem106b	C	T	6: 13,082,423	T199M	probably benign	Het
Tmem131	T	C	1: 36,796,292	T1583A	probably damaging	Het
Tom1	G	A	8: 75,051,965	V87I	probably null	Het
Treml4	G	T	17: 48,272,819		probably null	Het
Ttn	T	C	2: 76,714,113	K32843R	probably damaging	Het
Wdr95	T	G	5: 149,581,850	C223W	probably damaging	Het
Wipi1	C	T	11: 109,603,764	R81Q	probably benign	Het
Zc3h7a	G	A	16: 11,149,224	T568I	probably benign	Het
Zfp287	A	T	11: 62,724,817	I228N	probably damaging	Het
Zfp606	T	A	7: 12,489,592	V10E	probably damaging	Het

Other mutations in Dock10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Dock10	APN	1	80585012	missense	probably damaging	1.00
IGL00783:Dock10	APN	1	80572449	splice site	probably benign
IGL00784:Dock10	APN	1	80572449	splice site	probably benign
IGL00858:Dock10	APN	1	80568003	missense	possibly damaging	0.48
IGL01298:Dock10	APN	1	80531245	missense	probably damaging	1.00
IGL01351:Dock10	APN	1	80593159	missense	probably damaging	1.00
IGL01356:Dock10	APN	1	80523742	missense	probably damaging	1.00
IGL01584:Dock10	APN	1	80533850	missense	probably damaging	0.99
IGL01619:Dock10	APN	1	80634298	splice site	probably benign
IGL01678:Dock10	APN	1	80543352	missense	probably damaging	1.00
IGL01759:Dock10	APN	1	80526273	missense	probably damaging	1.00
IGL02238:Dock10	APN	1	80533793	missense	probably damaging	0.99
IGL02352:Dock10	APN	1	80505661	missense	probably damaging	1.00
IGL02359:Dock10	APN	1	80505661	missense	probably damaging	1.00
IGL02377:Dock10	APN	1	80584994	critical splice donor site	probably null
IGL02433:Dock10	APN	1	80530188	missense	probably damaging	1.00
IGL02471:Dock10	APN	1	80515622	missense	probably damaging	0.99
IGL02645:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02646:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02648:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02649:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02650:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02652:Dock10	APN	1	80592844	splice site	probably null
IGL02718:Dock10	APN	1	80523818	missense	probably benign	0.00
IGL02998:Dock10	APN	1	80573542	missense	probably damaging	1.00
IGL03057:Dock10	APN	1	80567371	missense	probably damaging	1.00
IGL03066:Dock10	APN	1	80585041	missense	probably benign	0.00
IGL03106:Dock10	APN	1	80568834	missense	probably damaging	0.98
IGL03148:Dock10	APN	1	80540358	missense	probably benign	0.01
IGL03271:Dock10	APN	1	80505409	missense	probably damaging	1.00
IGL03352:Dock10	APN	1	80606296	splice site	probably benign
LCD18:Dock10	UTSW	1	80716623	intron	probably benign
PIT4366001:Dock10	UTSW	1	80595721	missense	probably benign	0.30
PIT4581001:Dock10	UTSW	1	80505446	missense	probably damaging	1.00
R0019:Dock10	UTSW	1	80605925	missense	probably damaging	1.00
R0081:Dock10	UTSW	1	80606578	missense	probably damaging	0.99
R0095:Dock10	UTSW	1	80524071	missense	probably benign	0.00
R0241:Dock10	UTSW	1	80578623	missense	probably benign
R0241:Dock10	UTSW	1	80578623	missense	probably benign
R0255:Dock10	UTSW	1	80605876	missense	probably damaging	1.00
R0267:Dock10	UTSW	1	80512454	missense	probably damaging	1.00
R0299:Dock10	UTSW	1	80536929	missense	probably damaging	0.99
R0365:Dock10	UTSW	1	80595683	missense	probably damaging	1.00
R0387:Dock10	UTSW	1	80540276	missense	probably damaging	1.00
R0403:Dock10	UTSW	1	80524070	missense	possibly damaging	0.94
R0408:Dock10	UTSW	1	80540476	missense	probably benign	0.03
R0414:Dock10	UTSW	1	80535933	missense	possibly damaging	0.93
R0591:Dock10	UTSW	1	80541219	splice site	probably benign
R0698:Dock10	UTSW	1	80530178	missense	probably damaging	1.00
R0711:Dock10	UTSW	1	80523975	missense	probably damaging	1.00
R0925:Dock10	UTSW	1	80536940	missense	probably benign	0.20
R1162:Dock10	UTSW	1	80568842	missense	possibly damaging	0.58
R1370:Dock10	UTSW	1	80540343	missense	probably damaging	1.00
R1440:Dock10	UTSW	1	80549136	missense	probably benign	0.03
R1469:Dock10	UTSW	1	80512558	missense	probably benign	0.05
R1469:Dock10	UTSW	1	80512558	missense	probably benign	0.05
R1525:Dock10	UTSW	1	80606164	critical splice donor site	probably null
R1544:Dock10	UTSW	1	80592635	missense	probably benign	0.00
R1601:Dock10	UTSW	1	80549802	missense	probably benign	0.00
R1757:Dock10	UTSW	1	80533869	missense	probably damaging	1.00
R1765:Dock10	UTSW	1	80605823	missense	probably damaging	1.00
R1783:Dock10	UTSW	1	80574180	missense	probably benign	0.17
R1823:Dock10	UTSW	1	80543097	splice site	probably null
R1827:Dock10	UTSW	1	80530292	missense	probably benign	0.07
R1844:Dock10	UTSW	1	80543201	missense	probably damaging	0.99
R1856:Dock10	UTSW	1	80606568	missense	possibly damaging	0.46
R1974:Dock10	UTSW	1	80510426	missense	possibly damaging	0.50
R2006:Dock10	UTSW	1	80549789	missense	possibly damaging	0.95
R2112:Dock10	UTSW	1	80505642	missense	probably damaging	1.00
R2112:Dock10	UTSW	1	80505643	missense	probably damaging	0.99
R2113:Dock10	UTSW	1	80606563	missense	probably damaging	1.00
R2439:Dock10	UTSW	1	80532432	missense	probably damaging	1.00
R2566:Dock10	UTSW	1	80540253	missense	possibly damaging	0.88
R3086:Dock10	UTSW	1	80532357	missense	possibly damaging	0.91
R3766:Dock10	UTSW	1	80536926	missense	probably damaging	0.99
R3768:Dock10	UTSW	1	80532368	missense	probably damaging	1.00
R4009:Dock10	UTSW	1	80532431	missense	probably damaging	1.00
R4016:Dock10	UTSW	1	80606569	missense	probably damaging	1.00
R4179:Dock10	UTSW	1	80510417	missense	probably benign	0.00
R4243:Dock10	UTSW	1	80566755	missense	probably benign	0.00
R4244:Dock10	UTSW	1	80566755	missense	probably benign	0.00
R4245:Dock10	UTSW	1	80566755	missense	probably benign	0.00
R4674:Dock10	UTSW	1	80606620	missense	possibly damaging	0.79
R4696:Dock10	UTSW	1	80515613	missense	possibly damaging	0.95
R4789:Dock10	UTSW	1	80541281	missense	probably damaging	1.00
R4851:Dock10	UTSW	1	80549157	missense	probably benign	0.33
R4911:Dock10	UTSW	1	80606236	missense	probably damaging	1.00
R4976:Dock10	UTSW	1	80567994	critical splice donor site	probably null
R5086:Dock10	UTSW	1	80551472	missense	possibly damaging	0.89
R5119:Dock10	UTSW	1	80567994	critical splice donor site	probably null
R5301:Dock10	UTSW	1	80648256	missense	probably benign	0.41
R5404:Dock10	UTSW	1	80503913	intron	probably benign
R5457:Dock10	UTSW	1	80524064	missense	probably damaging	1.00
R5790:Dock10	UTSW	1	80505170	missense	probably benign	0.00
R5845:Dock10	UTSW	1	80505742	intron	probably benign
R5871:Dock10	UTSW	1	80541340	critical splice acceptor site	probably null
R5873:Dock10	UTSW	1	80574138	missense	probably damaging	1.00
R5881:Dock10	UTSW	1	80560923	missense	probably benign	0.19
R5895:Dock10	UTSW	1	80536959	missense	probably benign
R5935:Dock10	UTSW	1	80505587	intron	probably benign
R5965:Dock10	UTSW	1	80568744	splice site	probably null
R5966:Dock10	UTSW	1	80568508	missense	possibly damaging	0.84
R6008:Dock10	UTSW	1	80606173	missense	probably damaging	0.98
R6029:Dock10	UTSW	1	80536946	missense	possibly damaging	0.68
R6083:Dock10	UTSW	1	80532431	missense	probably damaging	1.00
R6145:Dock10	UTSW	1	80575904	nonsense	probably null
R6257:Dock10	UTSW	1	80503696	intron	probably benign
R6274:Dock10	UTSW	1	80538823	missense	probably damaging	1.00
R6324:Dock10	UTSW	1	80505176	missense	probably benign	0.03
R6346:Dock10	UTSW	1	80575856	splice site	probably null
R6476:Dock10	UTSW	1	80541242	nonsense	probably null
R6516:Dock10	UTSW	1	80540461	missense	probably damaging	1.00
R6526:Dock10	UTSW	1	80586351	missense	probably damaging	0.97
R6534:Dock10	UTSW	1	80503671	missense	probably benign	0.01
R6620:Dock10	UTSW	1	80592638	missense	probably benign	0.01
R6640:Dock10	UTSW	1	80533838	nonsense	probably null
R6669:Dock10	UTSW	1	80592855	missense	probably damaging	1.00
R6672:Dock10	UTSW	1	80512531	missense	probably benign	0.00
R6679:Dock10	UTSW	1	80566797	missense	probably benign	0.11
R6682:Dock10	UTSW	1	80512621	missense	probably damaging	1.00
R6712:Dock10	UTSW	1	80536866	missense	probably benign	0.00
R6726:Dock10	UTSW	1	80512430	missense	probably damaging	1.00
R6788:Dock10	UTSW	1	80531245	missense	probably damaging	1.00
R6805:Dock10	UTSW	1	80586690	missense	probably benign
R6815:Dock10	UTSW	1	80538859	missense	possibly damaging	0.94
R6818:Dock10	UTSW	1	80615365	missense	possibly damaging	0.95
R6867:Dock10	UTSW	1	80531259	missense	probably damaging	1.00
R7026:Dock10	UTSW	1	80501787	missense	probably benign	0.40
R7084:Dock10	UTSW	1	80503856	missense
R7087:Dock10	UTSW	1	80592826	missense	probably benign
R7158:Dock10	UTSW	1	80586872	critical splice acceptor site	probably null
R7191:Dock10	UTSW	1	80540331	missense	possibly damaging	0.93
R7214:Dock10	UTSW	1	80568529	missense	probably benign	0.01
R7255:Dock10	UTSW	1	80543099	critical splice donor site	probably null
R7320:Dock10	UTSW	1	80549704	critical splice donor site	probably null
R7359:Dock10	UTSW	1	80709348	missense	probably benign	0.01
R7423:Dock10	UTSW	1	80523780	missense	possibly damaging	0.67
R7464:Dock10	UTSW	1	80540315	missense	probably damaging	0.99
R7483:Dock10	UTSW	1	80515566	missense	probably benign	0.01
R7487:Dock10	UTSW	1	80585048	missense	probably benign	0.00
R7789:Dock10	UTSW	1	80559213	missense	possibly damaging	0.82
R7943:Dock10	UTSW	1	80648289	missense	probably damaging	0.98
R7962:Dock10	UTSW	1	80586368	missense	possibly damaging	0.88
R8079:Dock10	UTSW	1	80578704	missense	probably benign	0.00
R8086:Dock10	UTSW	1	80503990	missense	probably benign	0.17
R8184:Dock10	UTSW	1	80552752	missense	probably damaging	1.00
R8220:Dock10	UTSW	1	80528649	missense	probably null	1.00
R8225:Dock10	UTSW	1	80503730	nonsense	probably null
R8267:Dock10	UTSW	1	80540328	missense	probably benign	0.00
R8276:Dock10	UTSW	1	80528281	missense	probably benign
R8294:Dock10	UTSW	1	80510362	missense	possibly damaging	0.88
R8298:Dock10	UTSW	1	80536937	missense	probably benign	0.00
R8326:Dock10	UTSW	1	80606175	missense	possibly damaging	0.77
R8724:Dock10	UTSW	1	80592627	missense	probably benign	0.00
R8828:Dock10	UTSW	1	80543417	missense	probably damaging	1.00
R8846:Dock10	UTSW	1	80568069	missense	possibly damaging	0.93
R8919:Dock10	UTSW	1	80505430	missense	probably benign	0.00
R8950:Dock10	UTSW	1	80541299	missense	probably benign
R8993:Dock10	UTSW	1	80574171	missense	probably benign	0.21
R9028:Dock10	UTSW	1	80606295	splice site	probably benign
R9115:Dock10	UTSW	1	80512439	missense	probably damaging	1.00
R9327:Dock10	UTSW	1	80532467	missense	probably damaging	1.00
R9342:Dock10	UTSW	1	80592643	missense	probably benign
R9421:Dock10	UTSW	1	80523792	missense	probably damaging	1.00
R9431:Dock10	UTSW	1	80605876	missense	probably damaging	1.00
R9486:Dock10	UTSW	1	80501735	missense	unknown
R9521:Dock10	UTSW	1	80524046	missense	probably damaging	1.00
R9598:Dock10	UTSW	1	80648222	missense	probably benign	0.15
R9629:Dock10	UTSW	1	80503672	missense
R9703:Dock10	UTSW	1	80539823	missense	probably damaging	0.98
RF021:Dock10	UTSW	1	80564573	critical splice acceptor site	probably null
X0025:Dock10	UTSW	1	80536920	missense	probably damaging	0.98
X0065:Dock10	UTSW	1	80541260	missense	probably damaging	1.00
Z1088:Dock10	UTSW	1	80532347	missense	probably damaging	1.00
Z1176:Dock10	UTSW	1	80560954	missense	probably benign
Z1177:Dock10	UTSW	1	80559200	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCACCTGTGTGACAAGGACTAG -3'
(R):5'- AGTCAGCTTTGGTGGCTCAG -3'

Sequencing Primer
(F):5'- AAGTCACCTTTCTCTTCAACAGATG -3'
(R):5'- GTGGCTCAGCTACTGTTACGTC -3'

Posted On

2018-11-28