Incidental Mutation 'R6964:Dclre1c'
ID541862
Institutional Source Beutler Lab
Gene Symbol Dclre1c
Ensembl Gene ENSMUSG00000026648
Gene NameDNA cross-link repair 1C
SynonymsArtemis, Art, 9930121L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location3424131-3464130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3453169 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 363 (V363A)
Ref Sequence ENSEMBL: ENSMUSP00000110718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027956] [ENSMUST00000060618] [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000102988] [ENSMUST00000115066] [ENSMUST00000127540]
Predicted Effect probably benign
Transcript: ENSMUST00000027956
SMART Domains Protein: ENSMUSP00000027956
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
CHROMO 117 169 2.44e-11 SMART
Pfam:Pre-SET 212 309 4.4e-18 PFAM
SET 317 446 4.05e-41 SMART
PostSET 461 477 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060618
SMART Domains Protein: ENSMUSP00000054169
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
SET 70 226 6.61e-23 SMART
PostSET 241 257 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061852
AA Change: V493A

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648
AA Change: V493A

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 1.6e-22 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100458
SMART Domains Protein: ENSMUSP00000098026
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
CHROMO 6 67 2e-7 SMART
Pfam:Pre-SET 110 207 1.3e-17 PFAM
SET 215 344 4.05e-41 SMART
PostSET 359 375 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100463
SMART Domains Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 6.5e-23 PFAM
low complexity region 476 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102988
AA Change: V493A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100053
Gene: ENSMUSG00000026648
AA Change: V493A

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 8.8e-23 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
internal_repeat_1 518 534 4.97e-8 PROSPERO
internal_repeat_1 525 541 4.97e-8 PROSPERO
low complexity region 545 559 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115066
AA Change: V363A

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648
AA Change: V363A

DomainStartEndE-ValueType
Blast:Lactamase_B 25 70 1e-19 BLAST
Pfam:DRMBL 109 215 1.1e-22 PFAM
low complexity region 253 270 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
low complexity region 463 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127540
SMART Domains Protein: ENSMUSP00000125485
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129657
SMART Domains Protein: ENSMUSP00000116883
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Pfam:DRMBL 1 96 1.6e-21 PFAM
Meta Mutation Damage Score 0.1361 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SNM1 family of nucleases and is involved in V(D)J recombination and DNA repair. This protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins. The protein also functions in the regulation of the cell cycle in response to DNA damage. Homozygous knockout mice for this gene exhibit severe combined immunodeficiency with sensitivity to ionizing radiation. Mutations in this gene in humans can cause Athabascan-type severe combined immunodeficiency (SCIDA) and Omenn syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous mutant mice exhibit a combined immunodeficiency phenotype. While immunoglobulin rearrangement is completely blocked in B cells, the block of V(D)J rearrangement in T cells is partial. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Dclre1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Dclre1c APN 2 3433784 nonsense probably null
IGL02165:Dclre1c APN 2 3450381 splice site probably benign
IGL02955:Dclre1c APN 2 3438052 missense probably damaging 1.00
IGL02961:Dclre1c APN 2 3437033 missense probably damaging 1.00
Chairy UTSW 2 3452863 missense probably damaging 1.00
kiwis UTSW 2 3436475 missense probably damaging 1.00
kleiner UTSW 2 3424236 nonsense probably null
pee-wee UTSW 2 3437705 missense probably damaging 1.00
western_woods UTSW 2 3453169 missense possibly damaging 0.68
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0520:Dclre1c UTSW 2 3436475 missense probably damaging 1.00
R1922:Dclre1c UTSW 2 3440782 missense possibly damaging 0.95
R1994:Dclre1c UTSW 2 3437985 missense probably damaging 1.00
R4418:Dclre1c UTSW 2 3452935 missense possibly damaging 0.82
R4420:Dclre1c UTSW 2 3433745 critical splice acceptor site probably null
R4710:Dclre1c UTSW 2 3440861 critical splice donor site probably null
R5789:Dclre1c UTSW 2 3437956 missense probably damaging 1.00
R6113:Dclre1c UTSW 2 3452863 missense probably damaging 1.00
R6148:Dclre1c UTSW 2 3437705 missense probably damaging 1.00
R6519:Dclre1c UTSW 2 3429329 missense probably damaging 1.00
R7785:Dclre1c UTSW 2 3424236 nonsense probably null
R8111:Dclre1c UTSW 2 3447148 missense probably benign 0.00
R8828:Dclre1c UTSW 2 3443677 missense possibly damaging 0.89
R8926:Dclre1c UTSW 2 3433790 missense probably damaging 0.97
Z1088:Dclre1c UTSW 2 3438080 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGACCAGCCTGAACTGAGAC -3'
(R):5'- GTTGACTGAGATGAATTCTGGGAAG -3'

Sequencing Primer
(F):5'- CTGAACTGAGACAAAGCCCAGG -3'
(R):5'- AGAGATATGGGTGGAGTCTCC -3'
Posted On2018-11-28