Mutagenetix > Incidental Mutation

Incidental Mutation 'R6964:Olfr1245'

541866

Institutional Source

Beutler Lab

Gene Symbol

Olfr1245

Ensembl Gene

ENSMUSG00000111456

Gene Name

olfactory receptor 1245

Synonyms

GA_x6K02T2Q125-51020951-51020028, MOR231-12

MMRRC Submission

045074-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R6964 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89573406-89578447 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89574989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 246 (I246F)

Ref Sequence

ENSEMBL: ENSMUSP00000150791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]

AlphaFold

A0A1L1SQJ6

Predicted Effect

probably benign
Transcript: ENSMUST00000214870
AA Change: I246F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000217402
AA Change: I246F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630089N07Rik	A	T	16: 98,065,759	Y334*	probably null	Het
Abcc2	A	C	19: 43,798,076	I116L	probably benign	Het
Adamts17	T	A	7: 66,909,400	Y313N	possibly damaging	Het
Adamts17	A	G	7: 67,004,353	T444A	probably benign	Het
Adamtsl1	A	G	4: 86,156,854	I153V	probably damaging	Het
Ambra1	C	T	2: 91,917,416	Q1046*	probably null	Het
Ap1g2	A	T	14: 55,099,265	V750D	possibly damaging	Het
Bcl7a	T	C	5: 123,369,456		probably null	Het
C4bp	A	T	1: 130,657,272	L9Q	probably damaging	Het
Cadps2	A	C	6: 23,583,459	V344G	probably damaging	Het
Car7	A	G	8: 104,543,581	D15G	possibly damaging	Het
Cep126	G	C	9: 8,112,100	H157Q	probably null	Het
Chst11	C	T	10: 83,191,381	T214I	probably damaging	Het
Cntrob	G	A	11: 69,309,491	R526*	probably null	Het
Cul1	A	G	6: 47,516,509	T445A	probably benign	Het
Dclre1c	T	C	2: 3,453,169	V363A	possibly damaging	Het
Ddx58	A	G	4: 40,225,697	S235P	probably benign	Het
Dock10	T	A	1: 80,503,648		probably benign	Het
Donson	A	G	16: 91,681,219	Y465H	probably benign	Het
Eif3e	G	A	15: 43,272,289	A118V	probably benign	Het
Fam47e	A	T	5: 92,566,052	Q180L	probably damaging	Het
Fat1	T	G	8: 45,043,945	C4156G	probably damaging	Het
Fermt2	A	T	14: 45,465,142	I441K	probably damaging	Het
Frmd4b	C	T	6: 97,305,197	R510Q	probably damaging	Het
Fscn1	C	T	5: 142,960,660	A71V	probably damaging	Het
Gfap	G	A	11: 102,896,957	A54V	possibly damaging	Het
Gjc3	C	T	5: 137,957,497	M175I	probably benign	Het
Gm10645	C	T	8: 83,165,952		probably benign	Het
Haus5	G	A	7: 30,657,615	P464S	probably benign	Het
Helz2	T	A	2: 181,230,428	I2584F	probably damaging	Het
Mak	T	A	13: 41,032,591	I534L	probably benign	Het
Map3k9	T	C	12: 81,773,003	D159G	probably benign	Het
Mcat	A	G	15: 83,547,931		probably benign	Het
Meltf	A	G	16: 31,880,162	D30G	probably benign	Het
Ntng2	T	A	2: 29,197,029	Y452F	probably benign	Het
Olfr1130	T	C	2: 87,607,613	L75P	probably damaging	Het
Olfr1474	T	A	19: 13,471,361	Y130*	probably null	Het
Olfr473	A	T	7: 107,933,759	I80L	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pianp	T	A	6: 124,999,390	V54D	possibly damaging	Het
Ptprn	T	C	1: 75,260,649	D103G	possibly damaging	Het
Rhcg	A	G	7: 79,600,531	V268A	probably benign	Het
Rhoj	T	A	12: 75,375,389	Y74N	probably damaging	Het
Snx13	A	C	12: 35,119,789	T578P	possibly damaging	Het
Star	T	A	8: 25,811,823	H227Q	probably benign	Het
Stau2	A	C	1: 16,390,005	M204R	probably damaging	Het
Steap4	A	G	5: 7,975,568	Y43C	probably damaging	Het
Syt8	A	G	7: 142,439,421	E21G	probably benign	Het
Tacr3	T	C	3: 134,829,739	V156A	probably damaging	Het
Tmem106b	C	T	6: 13,082,423	T199M	probably benign	Het
Tmem131	T	C	1: 36,796,292	T1583A	probably damaging	Het
Tom1	G	A	8: 75,051,965	V87I	probably null	Het
Treml4	G	T	17: 48,272,819		probably null	Het
Ttn	T	C	2: 76,714,113	K32843R	probably damaging	Het
Wdr95	T	G	5: 149,581,850	C223W	probably damaging	Het
Wipi1	C	T	11: 109,603,764	R81Q	probably benign	Het
Zc3h7a	G	A	16: 11,149,224	T568I	probably benign	Het
Zfp287	A	T	11: 62,724,817	I228N	probably damaging	Het
Zfp606	T	A	7: 12,489,592	V10E	probably damaging	Het

Other mutations in Olfr1245

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01122:Olfr1245	APN	2	89575423	missense	possibly damaging	0.68
IGL01690:Olfr1245	APN	2	89575213	missense	probably benign	0.09
IGL02334:Olfr1245	APN	2	89575324	missense	possibly damaging	0.95
IGL02435:Olfr1245	APN	2	89575546	missense	probably damaging	0.99
IGL02793:Olfr1245	APN	2	89575552	missense	probably damaging	1.00
IGL02875:Olfr1245	APN	2	89575552	missense	probably damaging	1.00
IGL03218:Olfr1245	APN	2	89575591	missense	probably benign	0.09
IGL03392:Olfr1245	APN	2	89575249	missense	probably damaging	0.96
H8786:Olfr1245	UTSW	2	89575279	missense	probably damaging	1.00
I0000:Olfr1245	UTSW	2	89575153	missense	probably damaging	1.00
R0044:Olfr1245	UTSW	2	89575630	missense	possibly damaging	0.68
R0190:Olfr1245	UTSW	2	89574958	missense	probably damaging	0.98
R1585:Olfr1245	UTSW	2	89575402	missense	possibly damaging	0.89
R1902:Olfr1245	UTSW	2	89575603	missense	possibly damaging	0.77
R2018:Olfr1245	UTSW	2	89575393	missense	probably damaging	0.97
R2019:Olfr1245	UTSW	2	89575393	missense	probably damaging	0.97
R2020:Olfr1245	UTSW	2	89574961	missense	possibly damaging	0.88
R2021:Olfr1245	UTSW	2	89574961	missense	possibly damaging	0.88
R2030:Olfr1245	UTSW	2	89575214	missense	probably benign	0.00
R2133:Olfr1245	UTSW	2	89575256	nonsense	probably null
R3850:Olfr1245	UTSW	2	89575034	missense	probably damaging	0.99
R4066:Olfr1245	UTSW	2	89575179	missense	probably damaging	1.00
R4754:Olfr1245	UTSW	2	89575047	missense	probably benign
R4923:Olfr1245	UTSW	2	89575679	missense	probably damaging	0.98
R5303:Olfr1245	UTSW	2	89575001	missense	possibly damaging	0.88
R5574:Olfr1245	UTSW	2	89574977	missense	possibly damaging	0.94
R6083:Olfr1245	UTSW	2	89575672	missense	probably benign	0.42
R6188:Olfr1245	UTSW	2	89575194	nonsense	probably null
R6724:Olfr1245	UTSW	2	89574965	missense	probably benign	0.26
R7066:Olfr1245	UTSW	2	89575703	missense	probably damaging	0.98
R7401:Olfr1245	UTSW	2	89575105	missense	probably benign	0.27
R8232:Olfr1245	UTSW	2	89575594	missense	noncoding transcript
R8558:Olfr1245	UTSW	2	89574985	missense	probably damaging	1.00
R8708:Olfr1245	UTSW	2	89575279	missense	probably damaging	1.00
R9482:Olfr1245	UTSW	2	89575609	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGATAGAATTTTGCACCAGAGC -3'
(R):5'- ACTGGTGGTTTTACACACTCTC -3'

Sequencing Primer
(F):5'- GCACCAGAGCTTTTTCATACAAG -3'
(R):5'- TGGTACTTGCATGCACAGAC -3'

Posted On

2018-11-28