Mutagenetix > Incidental Mutation

Incidental Mutation 'R6964:Tacr3'

541869

Institutional Source

Beutler Lab

Gene Symbol

Tacr3

Ensembl Gene

ENSMUSG00000028172

Gene Name

tachykinin receptor 3

Synonyms

Tac3r, Nk3r, neuromedin K receptor

MMRRC Submission

045074-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6964 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

134829007-134934579 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134829739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 156 (V156A)

Ref Sequence

ENSEMBL: ENSMUSP00000029822 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029822]

AlphaFold

P47937

Predicted Effect

probably damaging
Transcript: ENSMUST00000029822
AA Change: V156A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000029822
Gene: ENSMUSG00000028172
AA Change: V156A

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	83	358	2.4e-11	PFAM
Pfam:7tm_1	89	343	3.6e-58	PFAM
low complexity region	433	447	N/A	INTRINSIC

Meta Mutation Damage Score

0.3946

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to a family of genes that function as receptors for tachykinins. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neurokinin 3, also referred to as neurokinin B. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight, cognitive deficits in tests associated with learning and memory and symptoms of hypogonadotropic hypogonadism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630089N07Rik	A	T	16: 98,065,759	Y334*	probably null	Het
Abcc2	A	C	19: 43,798,076	I116L	probably benign	Het
Adamts17	T	A	7: 66,909,400	Y313N	possibly damaging	Het
Adamts17	A	G	7: 67,004,353	T444A	probably benign	Het
Adamtsl1	A	G	4: 86,156,854	I153V	probably damaging	Het
Ambra1	C	T	2: 91,917,416	Q1046*	probably null	Het
Ap1g2	A	T	14: 55,099,265	V750D	possibly damaging	Het
Bcl7a	T	C	5: 123,369,456		probably null	Het
C4bp	A	T	1: 130,657,272	L9Q	probably damaging	Het
Cadps2	A	C	6: 23,583,459	V344G	probably damaging	Het
Car7	A	G	8: 104,543,581	D15G	possibly damaging	Het
Cep126	G	C	9: 8,112,100	H157Q	probably null	Het
Chst11	C	T	10: 83,191,381	T214I	probably damaging	Het
Cntrob	G	A	11: 69,309,491	R526*	probably null	Het
Cul1	A	G	6: 47,516,509	T445A	probably benign	Het
Dclre1c	T	C	2: 3,453,169	V363A	possibly damaging	Het
Ddx58	A	G	4: 40,225,697	S235P	probably benign	Het
Dock10	T	A	1: 80,503,648		probably benign	Het
Donson	A	G	16: 91,681,219	Y465H	probably benign	Het
Eif3e	G	A	15: 43,272,289	A118V	probably benign	Het
Fam47e	A	T	5: 92,566,052	Q180L	probably damaging	Het
Fat1	T	G	8: 45,043,945	C4156G	probably damaging	Het
Fermt2	A	T	14: 45,465,142	I441K	probably damaging	Het
Frmd4b	C	T	6: 97,305,197	R510Q	probably damaging	Het
Fscn1	C	T	5: 142,960,660	A71V	probably damaging	Het
Gfap	G	A	11: 102,896,957	A54V	possibly damaging	Het
Gjc3	C	T	5: 137,957,497	M175I	probably benign	Het
Gm10645	C	T	8: 83,165,952		probably benign	Het
Haus5	G	A	7: 30,657,615	P464S	probably benign	Het
Helz2	T	A	2: 181,230,428	I2584F	probably damaging	Het
Mak	T	A	13: 41,032,591	I534L	probably benign	Het
Map3k9	T	C	12: 81,773,003	D159G	probably benign	Het
Mcat	A	G	15: 83,547,931		probably benign	Het
Meltf	A	G	16: 31,880,162	D30G	probably benign	Het
Ntng2	T	A	2: 29,197,029	Y452F	probably benign	Het
Olfr1130	T	C	2: 87,607,613	L75P	probably damaging	Het
Olfr1245	T	A	2: 89,574,989	I246F	probably benign	Het
Olfr1474	T	A	19: 13,471,361	Y130*	probably null	Het
Olfr473	A	T	7: 107,933,759	I80L	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pianp	T	A	6: 124,999,390	V54D	possibly damaging	Het
Ptprn	T	C	1: 75,260,649	D103G	possibly damaging	Het
Rhcg	A	G	7: 79,600,531	V268A	probably benign	Het
Rhoj	T	A	12: 75,375,389	Y74N	probably damaging	Het
Snx13	A	C	12: 35,119,789	T578P	possibly damaging	Het
Star	T	A	8: 25,811,823	H227Q	probably benign	Het
Stau2	A	C	1: 16,390,005	M204R	probably damaging	Het
Steap4	A	G	5: 7,975,568	Y43C	probably damaging	Het
Syt8	A	G	7: 142,439,421	E21G	probably benign	Het
Tmem106b	C	T	6: 13,082,423	T199M	probably benign	Het
Tmem131	T	C	1: 36,796,292	T1583A	probably damaging	Het
Tom1	G	A	8: 75,051,965	V87I	probably null	Het
Treml4	G	T	17: 48,272,819		probably null	Het
Ttn	T	C	2: 76,714,113	K32843R	probably damaging	Het
Wdr95	T	G	5: 149,581,850	C223W	probably damaging	Het
Wipi1	C	T	11: 109,603,764	R81Q	probably benign	Het
Zc3h7a	G	A	16: 11,149,224	T568I	probably benign	Het
Zfp287	A	T	11: 62,724,817	I228N	probably damaging	Het
Zfp606	T	A	7: 12,489,592	V10E	probably damaging	Het

Other mutations in Tacr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Tacr3	APN	3	134854821	missense	probably benign	0.31
IGL00972:Tacr3	APN	3	134932355	missense	probably benign	0.19
IGL01291:Tacr3	APN	3	134930049	missense	probably damaging	1.00
IGL01417:Tacr3	APN	3	134829546	missense	possibly damaging	0.95
IGL01417:Tacr3	APN	3	134829481	missense	possibly damaging	0.52
IGL02282:Tacr3	APN	3	134861073	missense	probably benign	0.01
IGL02548:Tacr3	APN	3	134829471	missense	probably damaging	1.00
IGL02645:Tacr3	APN	3	134861182	missense	possibly damaging	0.46
IGL03085:Tacr3	APN	3	134932266	missense	possibly damaging	0.93
IGL03247:Tacr3	APN	3	134930091	splice site	probably benign
ANU05:Tacr3	UTSW	3	134930049	missense	probably damaging	1.00
R0355:Tacr3	UTSW	3	134932228	missense	probably benign	0.28
R0731:Tacr3	UTSW	3	134855000	critical splice donor site	probably null
R1570:Tacr3	UTSW	3	134829756	missense	probably damaging	0.97
R1686:Tacr3	UTSW	3	134829493	missense	probably damaging	1.00
R2129:Tacr3	UTSW	3	134854860	missense	probably damaging	1.00
R2130:Tacr3	UTSW	3	134932180	missense	probably benign	0.00
R2131:Tacr3	UTSW	3	134932180	missense	probably benign	0.00
R2352:Tacr3	UTSW	3	134854870	missense	probably benign	0.09
R4695:Tacr3	UTSW	3	134829421	missense	probably benign	0.01
R4695:Tacr3	UTSW	3	134929929	missense	probably damaging	1.00
R4840:Tacr3	UTSW	3	134854854	missense	possibly damaging	0.71
R4976:Tacr3	UTSW	3	134932272	missense	probably benign	0.14
R5168:Tacr3	UTSW	3	134829559	missense	probably damaging	1.00
R5924:Tacr3	UTSW	3	134932299	missense	possibly damaging	0.65
R6042:Tacr3	UTSW	3	134932392	missense	probably benign	0.01
R7653:Tacr3	UTSW	3	134861082	missense	probably benign	0.02
R7724:Tacr3	UTSW	3	134929908	missense	probably damaging	1.00
R8291:Tacr3	UTSW	3	134932149	missense	possibly damaging	0.80
R8987:Tacr3	UTSW	3	134854812	missense	probably damaging	1.00
R8987:Tacr3	UTSW	3	134854957	missense	probably damaging	0.99
R9077:Tacr3	UTSW	3	134929950	missense	probably benign	0.05
R9423:Tacr3	UTSW	3	134932282	missense	probably benign
R9501:Tacr3	UTSW	3	134829331	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGTCTTCGGAAACCTCATCG -3'
(R):5'- GGTCATGTGAACAGAAAATGGTTC -3'

Sequencing Primer
(F):5'- CGGAAACCTCATCGTTATTTGG -3'
(R):5'- GTGAACAGAAAATGGTTCACAGTTCC -3'

Posted On

2018-11-28