Incidental Mutation 'R6964:Fam47e'
ID541873
Institutional Source Beutler Lab
Gene Symbol Fam47e
Ensembl Gene ENSMUSG00000057068
Gene Namefamily with sequence similarity 47, member E
SynonymsGm1381, LOC384198
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location92555069-92591279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92566052 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 180 (Q180L)
Ref Sequence ENSEMBL: ENSMUSP00000115229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146417]
Predicted Effect probably damaging
Transcript: ENSMUST00000146417
AA Change: Q180L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115229
Gene: ENSMUSG00000057068
AA Change: Q180L

DomainStartEndE-ValueType
Pfam:FAM47 17 191 1.7e-31 PFAM
low complexity region 339 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149617
Meta Mutation Damage Score 0.3273 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Fam47e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Fam47e APN 5 92579663 missense probably damaging 1.00
R0646:Fam47e UTSW 5 92578458 intron probably benign
R1170:Fam47e UTSW 5 92565922 splice site probably benign
R1216:Fam47e UTSW 5 92562484 missense probably damaging 0.99
R1926:Fam47e UTSW 5 92585385 missense possibly damaging 0.61
R3434:Fam47e UTSW 5 92585362 missense probably damaging 0.99
R3435:Fam47e UTSW 5 92585362 missense probably damaging 0.99
R4899:Fam47e UTSW 5 92574669 missense probably benign 0.23
R4925:Fam47e UTSW 5 92585290 missense probably damaging 1.00
R5885:Fam47e UTSW 5 92565968 missense probably damaging 0.97
R6060:Fam47e UTSW 5 92579613 missense possibly damaging 0.88
R6278:Fam47e UTSW 5 92562517 missense probably damaging 1.00
R7661:Fam47e UTSW 5 92587525 missense probably damaging 0.97
R7992:Fam47e UTSW 5 92574682 missense probably damaging 1.00
R8349:Fam47e UTSW 5 92555131 missense probably benign 0.27
R8449:Fam47e UTSW 5 92555131 missense probably benign 0.27
Z1176:Fam47e UTSW 5 92579668 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGAATTGGGGCCCCTTTTCTC -3'
(R):5'- TGCCACTGCTAGAGAAACGAAC -3'

Sequencing Primer
(F):5'- GGGGCCCCTTTTCTCCAATTG -3'
(R):5'- AGTTTTCTAGATACCCAGGCATGGC -3'
Posted On2018-11-28