Incidental Mutation 'R6964:Cadps2'
ID 541879
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, cpd2, A230044C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6964 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 23262773-23839421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 23583459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 344 (V344G)
Ref Sequence ENSEMBL: ENSMUSP00000138167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000018122
AA Change: V373G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: V373G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069074
AA Change: V373G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: V373G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115356
AA Change: V373G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: V373G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115358
AA Change: V373G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: V373G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115361
AA Change: V373G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: V373G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125350
AA Change: V18G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: V18G

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142913
AA Change: V344G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: V344G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163871
AA Change: V373G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: V373G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166458
AA Change: V344G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: V344G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23587537 missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
R9228:Cadps2 UTSW 6 23688928 missense probably benign 0.00
R9297:Cadps2 UTSW 6 23496888 missense probably benign
R9318:Cadps2 UTSW 6 23496888 missense probably benign
R9348:Cadps2 UTSW 6 23344263 missense probably benign 0.20
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACAAGAGCATTTAATTGTGCA -3'
(R):5'- ACTGCCATTCCTTTCAAAGCTAT -3'

Sequencing Primer
(F):5'- CAAGAGCATTTAATTGTGCATGTAAG -3'
(R):5'- TTAGTGTGACCCAAATGGCC -3'
Posted On 2018-11-28