Incidental Mutation 'R6964:Pianp'
ID541882
Institutional Source Beutler Lab
Gene Symbol Pianp
Ensembl Gene ENSMUSG00000030329
Gene NamePILR alpha associated neural protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6964 (G1)
Quality Score209.009
Status Not validated
Chromosome6
Chromosomal Location124996694-125003096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124999390 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 54 (V54D)
Ref Sequence ENSEMBL: ENSMUSP00000123940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032479] [ENSMUST00000159391] [ENSMUST00000160666] [ENSMUST00000160704] [ENSMUST00000161292] [ENSMUST00000162000] [ENSMUST00000162170]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032479
AA Change: V54D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032479
Gene: ENSMUSG00000030329
AA Change: V54D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 272 2.1e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159391
AA Change: V54D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124024
Gene: ENSMUSG00000030329
AA Change: V54D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 165 5.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160666
SMART Domains Protein: ENSMUSP00000125328
Gene: ENSMUSG00000030329

DomainStartEndE-ValueType
Pfam:AJAP1_PANP_C 4 63 5.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160704
AA Change: V54D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124160
Gene: ENSMUSG00000030329
AA Change: V54D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 100 272 2.1e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161292
AA Change: V54D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125600
Gene: ENSMUSG00000030329
AA Change: V54D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162000
AA Change: V54D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145297
Gene: ENSMUSG00000030329
AA Change: V54D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 130 240 3.3e-8 PFAM
low complexity region 251 264 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162170
AA Change: V54D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123940
Gene: ENSMUSG00000030329
AA Change: V54D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:AJAP1_PANP_C 131 240 6.5e-12 PFAM
low complexity region 251 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand for the paired immunoglobin-like type 2 receptor alpha, and so may be involved in immune regulation. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Pianp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Pianp APN 6 125000683 missense possibly damaging 0.71
IGL02693:Pianp APN 6 125001635 missense possibly damaging 0.53
R0015:Pianp UTSW 6 125001540 missense probably damaging 1.00
R2208:Pianp UTSW 6 124999639 missense probably damaging 1.00
R6470:Pianp UTSW 6 124999269 unclassified probably benign
R6755:Pianp UTSW 6 124999384 missense probably benign 0.33
R6800:Pianp UTSW 6 125001602 missense possibly damaging 0.93
R7553:Pianp UTSW 6 124999251 missense unknown
R8409:Pianp UTSW 6 124999251 missense unknown
Predicted Primers PCR Primer
(F):5'- GACTCCTGGTGCAAACCTAC -3'
(R):5'- ATCCTCCCGAGATACTGTGG -3'

Sequencing Primer
(F):5'- CTACATGAGCCATCGCCTG -3'
(R):5'- TCCCGAGATACTGTGGGACCC -3'
Posted On2018-11-28