Incidental Mutation 'R6964:Zfp606'
ID541883
Institutional Source Beutler Lab
Gene Symbol Zfp606
Ensembl Gene ENSMUSG00000030386
Gene Namezinc finger protein 606
Synonyms2410022M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12478293-12496235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12489592 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 10 (V10E)
Ref Sequence ENSEMBL: ENSMUSP00000148075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098822] [ENSMUST00000151933] [ENSMUST00000209403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098822
AA Change: V68E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096421
Gene: ENSMUSG00000030386
AA Change: V68E

DomainStartEndE-ValueType
KRAB 63 123 3.36e-39 SMART
ZnF_C2H2 291 313 1.83e2 SMART
ZnF_C2H2 403 425 2.89e1 SMART
ZnF_C2H2 431 453 2.3e-5 SMART
ZnF_C2H2 459 481 1.28e-3 SMART
ZnF_C2H2 487 509 3.95e-4 SMART
ZnF_C2H2 515 537 5.67e-5 SMART
ZnF_C2H2 543 565 6.88e-4 SMART
ZnF_C2H2 571 593 9.22e-5 SMART
ZnF_C2H2 599 621 1.95e-3 SMART
ZnF_C2H2 627 649 1.47e-3 SMART
ZnF_C2H2 655 677 3.39e-3 SMART
ZnF_C2H2 683 705 4.11e-2 SMART
ZnF_C2H2 711 733 4.87e-4 SMART
ZnF_C2H2 739 761 1.67e-2 SMART
ZnF_C2H2 767 789 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151933
SMART Domains Protein: ENSMUSP00000122197
Gene: ENSMUSG00000030386

DomainStartEndE-ValueType
KRAB 5 65 3.36e-39 SMART
ZnF_C2H2 233 255 1.83e2 SMART
ZnF_C2H2 345 367 2.89e1 SMART
ZnF_C2H2 373 395 2.3e-5 SMART
ZnF_C2H2 401 423 1.28e-3 SMART
ZnF_C2H2 429 451 3.95e-4 SMART
ZnF_C2H2 457 479 5.67e-5 SMART
ZnF_C2H2 485 507 6.88e-4 SMART
ZnF_C2H2 513 535 9.22e-5 SMART
ZnF_C2H2 541 563 1.95e-3 SMART
ZnF_C2H2 569 591 1.47e-3 SMART
ZnF_C2H2 597 619 3.39e-3 SMART
ZnF_C2H2 625 647 4.11e-2 SMART
ZnF_C2H2 653 675 4.87e-4 SMART
ZnF_C2H2 681 703 1.67e-2 SMART
ZnF_C2H2 709 731 2.4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209403
AA Change: V10E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein containing a Kruppel-associated box (KRAB) domain at its N-terminus, followed by contiguous C2H2 zinc finger motifs. The encoded protein is a nuclear protein that can act as a transcriptional repressor of growth factor-mediated signaling pathways in a reporter gene assay. This protein has been shown to interact with the SRY-box 9 gene product, and suppresses its transcriptional activity by inhibiting its DNA binding activity. Reduced expression of this gene promotes chondrocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Other mutations in Zfp606
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1680:Zfp606 UTSW 7 12493971 missense probably damaging 1.00
R1861:Zfp606 UTSW 7 12480931 unclassified probably benign
R1943:Zfp606 UTSW 7 12493688 missense probably damaging 1.00
R2142:Zfp606 UTSW 7 12479726 missense probably damaging 0.99
R2340:Zfp606 UTSW 7 12493089 missense possibly damaging 0.91
R3426:Zfp606 UTSW 7 12489664 missense probably damaging 0.99
R4208:Zfp606 UTSW 7 12494175 missense probably damaging 1.00
R4258:Zfp606 UTSW 7 12494340 splice site probably null
R4383:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R4393:Zfp606 UTSW 7 12492849 missense probably damaging 1.00
R4782:Zfp606 UTSW 7 12494005 missense probably damaging 1.00
R4858:Zfp606 UTSW 7 12493056 missense possibly damaging 0.89
R5668:Zfp606 UTSW 7 12492552 missense probably benign 0.28
R5704:Zfp606 UTSW 7 12493529 missense probably damaging 0.99
R6064:Zfp606 UTSW 7 12481033 missense possibly damaging 0.82
R6080:Zfp606 UTSW 7 12494116 missense probably damaging 1.00
R6190:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R6383:Zfp606 UTSW 7 12492944 missense probably benign 0.18
R7193:Zfp606 UTSW 7 12494039 missense probably benign 0.32
R7507:Zfp606 UTSW 7 12492941 missense probably benign 0.18
R7997:Zfp606 UTSW 7 12489592 missense probably damaging 1.00
R7997:Zfp606 UTSW 7 12494207 missense possibly damaging 0.86
R8078:Zfp606 UTSW 7 12481015 missense possibly damaging 0.85
R8209:Zfp606 UTSW 7 12493307 missense probably benign 0.13
R8254:Zfp606 UTSW 7 12492861 missense possibly damaging 0.51
R8701:Zfp606 UTSW 7 12481098 missense unknown
R8904:Zfp606 UTSW 7 12489579 missense possibly damaging 0.71
Z1176:Zfp606 UTSW 7 12481025 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGTGCTACTCAGTTAAACTTG -3'
(R):5'- CATACTTCTTTCACAGGATAGCTG -3'

Sequencing Primer
(F):5'- GAACTCACTATGTAGTCCAGACTGG -3'
(R):5'- CTTTCACAGGATAGCTGAAGACACTG -3'
Posted On2018-11-28