Incidental Mutation 'R6964:Olfr473'
ID541888
Institutional Source Beutler Lab
Gene Symbol Olfr473
Ensembl Gene ENSMUSG00000095212
Gene Nameolfactory receptor 473
SynonymsGA_x6K02T2PBJ9-10262759-10263691, MOR204-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107930446-107935661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107933759 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 80 (I80L)
Ref Sequence ENSEMBL: ENSMUSP00000150610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084761] [ENSMUST00000217618]
Predicted Effect probably benign
Transcript: ENSMUST00000084761
AA Change: I80L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081816
Gene: ENSMUSG00000095212
AA Change: I80L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.4e-49 PFAM
Pfam:7tm_1 41 290 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217618
AA Change: I80L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Olfr473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Olfr473 APN 7 107934277 nonsense probably null
IGL02361:Olfr473 APN 7 107934277 nonsense probably null
IGL03228:Olfr473 APN 7 107934123 missense possibly damaging 0.94
R0255:Olfr473 UTSW 7 107934168 missense probably damaging 0.96
R0306:Olfr473 UTSW 7 107933700 missense probably damaging 1.00
R1126:Olfr473 UTSW 7 107934371 missense possibly damaging 0.76
R1313:Olfr473 UTSW 7 107933768 missense probably benign 0.01
R1313:Olfr473 UTSW 7 107933768 missense probably benign 0.01
R1860:Olfr473 UTSW 7 107934390 missense probably damaging 1.00
R2060:Olfr473 UTSW 7 107933661 missense probably benign 0.00
R2386:Olfr473 UTSW 7 107934273 missense probably damaging 0.99
R4324:Olfr473 UTSW 7 107933693 missense probably damaging 1.00
R4847:Olfr473 UTSW 7 107933827 nonsense probably null
R5926:Olfr473 UTSW 7 107933903 missense probably damaging 0.98
R8024:Olfr473 UTSW 7 107934438 missense probably benign 0.00
R8377:Olfr473 UTSW 7 107933685 missense probably damaging 1.00
X0063:Olfr473 UTSW 7 107934345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAACCATACCACGGTGG -3'
(R):5'- CAGACTCTAGGGGACATGAGTG -3'

Sequencing Primer
(F):5'- AGGACCCCAAGCTGTGTATAGTC -3'
(R):5'- ACATGAGTGTCGAATACAGGAG -3'
Posted On2018-11-28