Incidental Mutation 'R6964:Syt8'
ID541889
Institutional Source Beutler Lab
Gene Symbol Syt8
Ensembl Gene ENSMUSG00000031098
Gene Namesynaptotagmin VIII
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location142434850-142440396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142439421 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 21 (E21G)
Ref Sequence ENSEMBL: ENSMUSP00000147572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097939] [ENSMUST00000105971] [ENSMUST00000105973] [ENSMUST00000105976] [ENSMUST00000105977] [ENSMUST00000118276] [ENSMUST00000122393] [ENSMUST00000145287] [ENSMUST00000149529] [ENSMUST00000210239] [ENSMUST00000210746]
Predicted Effect probably benign
Transcript: ENSMUST00000097939
AA Change: E199G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095552
Gene: ENSMUSG00000031098
AA Change: E199G

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
C2 123 222 1.86e-15 SMART
C2 251 361 8.69e-16 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105971
SMART Domains Protein: ENSMUSP00000101591
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 145 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105973
SMART Domains Protein: ENSMUSP00000101593
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 10 153 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105976
AA Change: E199G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101596
Gene: ENSMUSG00000031098
AA Change: E199G

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
C2 123 222 1.86e-15 SMART
C2 251 361 8.69e-16 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105977
SMART Domains Protein: ENSMUSP00000101597
Gene: ENSMUSG00000031098

DomainStartEndE-ValueType
Pfam:UPF0560 14 88 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118276
AA Change: E205G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113545
Gene: ENSMUSG00000031098
AA Change: E205G

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
C2 129 228 1.86e-15 SMART
C2 257 367 8.69e-16 SMART
low complexity region 386 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122393
AA Change: E205G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112689
Gene: ENSMUSG00000031098
AA Change: E205G

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
C2 129 228 1.86e-15 SMART
C2 257 367 8.69e-16 SMART
low complexity region 386 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145287
SMART Domains Protein: ENSMUSP00000121819
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 135 4.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149529
SMART Domains Protein: ENSMUSP00000122733
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 145 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210239
Predicted Effect probably benign
Transcript: ENSMUST00000210746
AA Change: E21G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptotagmin protein family. Synaptotagmins are membrane proteins that are important in neurotransmission and hormone secretion, both of which involve regulated exocytosis. Expression of the encoded protein in human pancreatic islets has been connected to activity of the promoter for the insulin gene, on the same chromosome several hundred kilobases away (PMID: 21336277 and 22928559). This association would link response to gluclose to insulin secretion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Syt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Syt8 APN 7 142440140 missense probably damaging 1.00
R0032:Syt8 UTSW 7 142439189 missense probably benign 0.00
R0032:Syt8 UTSW 7 142439189 missense probably benign 0.00
R1819:Syt8 UTSW 7 142438234 missense possibly damaging 0.81
R4549:Syt8 UTSW 7 142439462 missense probably benign 0.13
R4550:Syt8 UTSW 7 142439462 missense probably benign 0.13
R8008:Syt8 UTSW 7 142438522 missense probably benign 0.00
R8052:Syt8 UTSW 7 142440144 missense probably damaging 0.97
R8139:Syt8 UTSW 7 142438268 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGTTTGAAGAGACATGCTGC -3'
(R):5'- CTCAGGCTATGGGCAACAAG -3'

Sequencing Primer
(F):5'- AAGAGACATGCTGCTTTCTGGTAAG -3'
(R):5'- TTTGAACTCAGCAGGTACAGC -3'
Posted On2018-11-28