Incidental Mutation 'R6964:Star'
ID541890
Institutional Source Beutler Lab
Gene Symbol Star
Ensembl Gene ENSMUSG00000031574
Gene Namesteroidogenic acute regulatory protein
SynonymsD8Ertd419e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location25806555-25815982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25811823 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 227 (H227Q)
Ref Sequence ENSEMBL: ENSMUSP00000033979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033979] [ENSMUST00000068892] [ENSMUST00000139946] [ENSMUST00000210565]
Predicted Effect probably benign
Transcript: ENSMUST00000033979
AA Change: H227Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000033979
Gene: ENSMUSG00000031574
AA Change: H227Q

DomainStartEndE-ValueType
START 75 280 3.63e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068892
SMART Domains Protein: ENSMUSP00000070957
Gene: ENSMUSG00000031575

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-136 PDB
Blast:PHD 103 146 2e-6 BLAST
low complexity region 280 306 N/A INTRINSIC
SPRY 413 577 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139946
SMART Domains Protein: ENSMUSP00000118346
Gene: ENSMUSG00000031575

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-141 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 278 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210565
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to thrive and die during the postnatal period due to adrenocortical insufficiency. Mice exhibit male pseudohermaprhoditism and show a progressive accumulation of lipids within steroidogenic cells of the adrenal glands and gonads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Star
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Star APN 8 25812866 splice site probably null
IGL01337:Star APN 8 25809864 missense probably damaging 1.00
IGL02165:Star APN 8 25812815 missense possibly damaging 0.75
IGL03274:Star APN 8 25811054 missense possibly damaging 0.72
BB001:Star UTSW 8 25809855 missense possibly damaging 0.72
BB011:Star UTSW 8 25809855 missense possibly damaging 0.72
R1327:Star UTSW 8 25809837 missense probably benign 0.45
R3816:Star UTSW 8 25809877 missense probably benign 0.15
R4790:Star UTSW 8 25808616 missense probably damaging 0.99
R5490:Star UTSW 8 25809917 missense probably damaging 1.00
R6362:Star UTSW 8 25811807 missense probably benign 0.18
R7924:Star UTSW 8 25809855 missense possibly damaging 0.72
R8805:Star UTSW 8 25809549 missense probably benign 0.01
R8882:Star UTSW 8 25812869 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGTTCTGATGAGCTAGTACCC -3'
(R):5'- CAGTGTCCTCAGACTTCCAC -3'

Sequencing Primer
(F):5'- TGATGAGCTAGTACCCATGCC -3'
(R):5'- TTGCTGTCACACATGAGCAC -3'
Posted On2018-11-28