Incidental Mutation 'R6964:Tom1'
ID541892
Institutional Source Beutler Lab
Gene Symbol Tom1
Ensembl Gene ENSMUSG00000042870
Gene Nametarget of myb1 trafficking protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location75033705-75070121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75051965 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 87 (V87I)
Ref Sequence ENSEMBL: ENSMUSP00000148670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078847] [ENSMUST00000165630] [ENSMUST00000211869] [ENSMUST00000212299] [ENSMUST00000212388] [ENSMUST00000212564] [ENSMUST00000212651]
Predicted Effect probably null
Transcript: ENSMUST00000078847
AA Change: V137I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077891
Gene: ENSMUSG00000042870
AA Change: V137I

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 228 303 1.7e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165630
AA Change: V137I

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130854
Gene: ENSMUSG00000042870
AA Change: V137I

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 212 312 5.1e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211869
Predicted Effect probably null
Transcript: ENSMUST00000212299
AA Change: V87I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212388
Predicted Effect probably benign
Transcript: ENSMUST00000212564
Predicted Effect probably null
Transcript: ENSMUST00000212651
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a target of the v-myb oncogene. The encoded protein shares its N-terminal domain in common with proteins associated with vesicular trafficking at the endosome. It is recruited to the endosomes by its interaction with endofin. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Tom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tom1 APN 8 75052174 missense probably benign 0.27
IGL00979:Tom1 APN 8 75054703 unclassified probably benign
IGL01143:Tom1 APN 8 75058457 missense probably benign 0.00
IGL02825:Tom1 APN 8 75057255 missense probably damaging 1.00
R0335:Tom1 UTSW 8 75064392 critical splice acceptor site probably null
R0762:Tom1 UTSW 8 75052306 splice site probably benign
R1317:Tom1 UTSW 8 75051551 missense probably benign 0.03
R1509:Tom1 UTSW 8 75054631 missense probably damaging 1.00
R1691:Tom1 UTSW 8 75051599 missense probably damaging 1.00
R1761:Tom1 UTSW 8 75051551 missense probably benign 0.03
R1906:Tom1 UTSW 8 75051590 missense probably damaging 1.00
R3966:Tom1 UTSW 8 75059239 missense probably benign 0.05
R5004:Tom1 UTSW 8 75052002 missense probably damaging 1.00
R5513:Tom1 UTSW 8 75057220 missense probably damaging 0.99
R5906:Tom1 UTSW 8 75050258 missense probably damaging 1.00
R6147:Tom1 UTSW 8 75054692 missense possibly damaging 0.90
R7010:Tom1 UTSW 8 75051975 missense probably damaging 0.98
R7131:Tom1 UTSW 8 75057249 missense possibly damaging 0.88
R7147:Tom1 UTSW 8 75057267 missense probably damaging 1.00
R8701:Tom1 UTSW 8 75052168 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCACTGTGTGCTGAGCCTG -3'
(R):5'- AGTTGAATACAGTCTAAGGGGC -3'

Sequencing Primer
(F):5'- TGTGCTGAGCCTGGTACAC -3'
(R):5'- TTGAATACAGTCTAAGGGGCAAAAG -3'
Posted On2018-11-28