Incidental Mutation 'R6964:Car7'
ID541894
Institutional Source Beutler Lab
Gene Symbol Car7
Ensembl Gene ENSMUSG00000031883
Gene Namecarbonic anhydrase 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location104534689-104550343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104543581 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 15 (D15G)
Ref Sequence ENSEMBL: ENSMUSP00000125404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056051] [ENSMUST00000159416] [ENSMUST00000162761]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056051
AA Change: D71G

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052136
Gene: ENSMUSG00000031883
AA Change: D71G

DomainStartEndE-ValueType
Carb_anhydrase 7 262 7.17e-144 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159416
AA Change: D15G

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125112
Gene: ENSMUSG00000031883
AA Change: D15G

DomainStartEndE-ValueType
Carb_anhydrase 1 206 1.93e-94 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162761
AA Change: D15G

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125404
Gene: ENSMUSG00000031883
AA Change: D15G

DomainStartEndE-ValueType
Carb_anhydrase 1 206 1.93e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. The cytosolic protein encoded by this gene is predominantly expressed in the salivary glands. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced and atypical experimental febrile seizures with the absence of electrographic seizures and abnormal GABA-mediated receptor currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Car7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Car7 APN 8 104549548 splice site probably null
IGL02306:Car7 APN 8 104548998 missense probably damaging 1.00
IGL02936:Car7 APN 8 104548222 missense possibly damaging 0.82
IGL03125:Car7 APN 8 104548219 missense probably benign 0.00
R0409:Car7 UTSW 8 104548424 missense probably damaging 1.00
R0485:Car7 UTSW 8 104543538 missense probably benign 0.00
R1981:Car7 UTSW 8 104548377 splice site probably benign
R2129:Car7 UTSW 8 104548973 missense possibly damaging 0.91
R7483:Car7 UTSW 8 104549584 missense probably benign 0.12
R7635:Car7 UTSW 8 104548437 missense probably damaging 1.00
X0020:Car7 UTSW 8 104549003 missense probably damaging 1.00
Z1176:Car7 UTSW 8 104548959 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTGTCTCCCAGAGCTTGAC -3'
(R):5'- CCCCAGGGAATATCTTATTGCTCC -3'

Sequencing Primer
(F):5'- TCTATCTATAGGCCCTTCAAATTGG -3'
(R):5'- CCATTTTATGCAATGAGAGGCTGAGC -3'
Posted On2018-11-28