Incidental Mutation 'R6964:Zfp287'
ID541897
Institutional Source Beutler Lab
Gene Symbol Zfp287
Ensembl Gene ENSMUSG00000005267
Gene Namezinc finger protein 287
SynonymsB230333C16Rik, SKAT-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location62700356-62731905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62724817 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 228 (I228N)
Ref Sequence ENSEMBL: ENSMUSP00000121717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005399] [ENSMUST00000128370] [ENSMUST00000149228] [ENSMUST00000150336] [ENSMUST00000185656]
Predicted Effect probably damaging
Transcript: ENSMUST00000005399
AA Change: I217N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005399
Gene: ENSMUSG00000005267
AA Change: I217N

DomainStartEndE-ValueType
SCAN 27 138 1e-50 SMART
KRAB 155 212 5.79e-20 SMART
low complexity region 253 262 N/A INTRINSIC
ZnF_C2H2 355 377 5.9e-3 SMART
ZnF_C2H2 383 405 2.61e-4 SMART
ZnF_C2H2 411 433 5.59e-4 SMART
ZnF_C2H2 439 461 3.44e-4 SMART
ZnF_C2H2 467 489 9.73e-4 SMART
ZnF_C2H2 495 517 2.43e-4 SMART
ZnF_C2H2 523 545 4.54e-4 SMART
ZnF_C2H2 551 573 2.57e-3 SMART
ZnF_C2H2 579 601 4.87e-4 SMART
ZnF_C2H2 607 629 1.3e-4 SMART
ZnF_C2H2 635 657 4.79e-3 SMART
ZnF_C2H2 663 685 2.95e-3 SMART
ZnF_C2H2 691 713 3.63e-3 SMART
ZnF_C2H2 719 741 1.38e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128370
AA Change: I217N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117179
Gene: ENSMUSG00000005267
AA Change: I217N

DomainStartEndE-ValueType
SCAN 27 138 1e-50 SMART
KRAB 155 212 5.79e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149228
AA Change: I228N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114531
Gene: ENSMUSG00000005267
AA Change: I228N

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150336
AA Change: I228N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121717
Gene: ENSMUSG00000005267
AA Change: I228N

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185656
AA Change: I228N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141046
Gene: ENSMUSG00000005267
AA Change: I228N

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the krueppel family of zinc finger proteins, suggesting a role as a transcription factor. Its specific function has not been determined. This gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Zfp287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Zfp287 APN 11 62713890 nonsense probably null
IGL01868:Zfp287 APN 11 62715257 missense probably benign 0.22
IGL03290:Zfp287 APN 11 62715236 missense probably damaging 0.98
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0193:Zfp287 UTSW 11 62715029 missense probably benign 0.12
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0525:Zfp287 UTSW 11 62715244 missense probably benign
R0725:Zfp287 UTSW 11 62714213 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1416:Zfp287 UTSW 11 62714340 missense probably damaging 1.00
R1487:Zfp287 UTSW 11 62725289 missense probably damaging 1.00
R2023:Zfp287 UTSW 11 62714982 nonsense probably null
R2045:Zfp287 UTSW 11 62727569 missense probably damaging 1.00
R2495:Zfp287 UTSW 11 62714633 missense probably damaging 1.00
R3794:Zfp287 UTSW 11 62714244 missense probably damaging 1.00
R3902:Zfp287 UTSW 11 62712202 missense probably benign 0.00
R4816:Zfp287 UTSW 11 62714248 missense probably damaging 1.00
R4928:Zfp287 UTSW 11 62714136 nonsense probably null
R5048:Zfp287 UTSW 11 62714951 missense probably damaging 0.98
R5858:Zfp287 UTSW 11 62714007 missense probably damaging 1.00
R6349:Zfp287 UTSW 11 62725342 missense probably damaging 0.99
R7024:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R7252:Zfp287 UTSW 11 62724829 missense probably damaging 1.00
R7318:Zfp287 UTSW 11 62714278 missense probably damaging 1.00
R7548:Zfp287 UTSW 11 62713875 nonsense probably null
R7658:Zfp287 UTSW 11 62725263 missense probably damaging 1.00
Z1186:Zfp287 UTSW 11 62713807 missense probably benign 0.00
Z1186:Zfp287 UTSW 11 62715349 missense probably benign
Z1186:Zfp287 UTSW 11 62722931 nonsense probably null
Z1187:Zfp287 UTSW 11 62713807 missense probably benign 0.00
Z1187:Zfp287 UTSW 11 62715349 missense probably benign
Z1187:Zfp287 UTSW 11 62722931 nonsense probably null
Z1188:Zfp287 UTSW 11 62713807 missense probably benign 0.00
Z1188:Zfp287 UTSW 11 62715349 missense probably benign
Z1188:Zfp287 UTSW 11 62722931 nonsense probably null
Z1189:Zfp287 UTSW 11 62713807 missense probably benign 0.00
Z1189:Zfp287 UTSW 11 62715349 missense probably benign
Z1189:Zfp287 UTSW 11 62722931 nonsense probably null
Z1190:Zfp287 UTSW 11 62713807 missense probably benign 0.00
Z1190:Zfp287 UTSW 11 62715349 missense probably benign
Z1190:Zfp287 UTSW 11 62722931 nonsense probably null
Z1191:Zfp287 UTSW 11 62713807 missense probably benign 0.00
Z1191:Zfp287 UTSW 11 62715349 missense probably benign
Z1191:Zfp287 UTSW 11 62722931 nonsense probably null
Z1192:Zfp287 UTSW 11 62713807 missense probably benign 0.00
Z1192:Zfp287 UTSW 11 62715349 missense probably benign
Z1192:Zfp287 UTSW 11 62722931 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTCGAGATGTTCTTAGAGTTG -3'
(R):5'- TACACGAGCCATTGTCTCCC -3'

Sequencing Primer
(F):5'- GAGCTCAGCAACCCTTCCTG -3'
(R):5'- ATTGTCTCCCCACAGAGGC -3'
Posted On2018-11-28