Incidental Mutation 'R6964:Cntrob'
ID541898
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Namecentrobin, centrosomal BRCA2 interacting protein
SynonymsLip8, 9830165K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69299487-69323775 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 69309491 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 526 (R526*)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176]
Predicted Effect probably null
Transcript: ENSMUST00000092973
AA Change: R526*
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: R526*

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000135979
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Meta Mutation Damage Score 0.9707 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69319373 missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69310027 missense possibly damaging 0.90
groats UTSW 11 69309491 nonsense probably null
BB005:Cntrob UTSW 11 69300295 missense probably damaging 0.97
BB015:Cntrob UTSW 11 69300295 missense probably damaging 0.97
R0270:Cntrob UTSW 11 69311341 missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69322868 missense probably damaging 1.00
R1749:Cntrob UTSW 11 69322874 missense probably damaging 0.99
R1775:Cntrob UTSW 11 69320867 missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69308054 missense probably benign 0.27
R1967:Cntrob UTSW 11 69320963 missense probably damaging 0.97
R2495:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R3121:Cntrob UTSW 11 69322700 nonsense probably null
R3780:Cntrob UTSW 11 69302882 missense probably damaging 0.97
R4449:Cntrob UTSW 11 69305549 missense probably benign 0.29
R4696:Cntrob UTSW 11 69320888 missense probably damaging 1.00
R4841:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69320906 missense probably damaging 0.97
R4982:Cntrob UTSW 11 69311362 splice site probably null
R5168:Cntrob UTSW 11 69299990 missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69321891 missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69314750 missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69322753 missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69309375 missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69311422 missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R7020:Cntrob UTSW 11 69303092 critical splice donor site probably null
R7425:Cntrob UTSW 11 69314734 nonsense probably null
R7928:Cntrob UTSW 11 69300295 missense probably damaging 0.97
R7946:Cntrob UTSW 11 69315221 missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69299853 missense unknown
R8448:Cntrob UTSW 11 69299853 missense unknown
R8539:Cntrob UTSW 11 69320826 missense possibly damaging 0.94
Z1177:Cntrob UTSW 11 69311449 missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69305578 missense probably benign
Z1186:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1187:Cntrob UTSW 11 69305578 missense probably benign
Z1187:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1188:Cntrob UTSW 11 69305578 missense probably benign
Z1188:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1189:Cntrob UTSW 11 69305578 missense probably benign
Z1189:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1190:Cntrob UTSW 11 69305578 missense probably benign
Z1190:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1191:Cntrob UTSW 11 69305578 missense probably benign
Z1191:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1192:Cntrob UTSW 11 69305578 missense probably benign
Z1192:Cntrob UTSW 11 69308056 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTTGGAGAGCTATGACCATGG -3'
(R):5'- CTTCAGGTCTGATACTGCACCC -3'

Sequencing Primer
(F):5'- CTATTTGGGCAGGGCAGC -3'
(R):5'- AAAGCTCGCCAGTTTGACTG -3'
Posted On2018-11-28