Incidental Mutation 'R6964:Zc3h7a'
ID541910
Institutional Source Beutler Lab
Gene Symbol Zc3h7a
Ensembl Gene ENSMUSG00000037965
Gene Namezinc finger CCCH type containing 7 A
SynonymsZc3h7, A430104C18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location11136592-11176393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11149224 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 568 (T568I)
Ref Sequence ENSEMBL: ENSMUSP00000114246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000128083] [ENSMUST00000138185] [ENSMUST00000140755]
Predicted Effect probably benign
Transcript: ENSMUST00000037633
AA Change: T568I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965
AA Change: T568I

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128083
AA Change: T568I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965
AA Change: T568I

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 2.7e-8 PFAM
Blast:TPR 124 156 4e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138185
AA Change: T568I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965
AA Change: T568I

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 3.9e-8 PFAM
Blast:TPR 124 156 6e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 4e-10 BLAST
Blast:ZnF_C3H1 628 654 5e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140755
SMART Domains Protein: ENSMUSP00000120720
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 1e-7 PFAM
Blast:TPR 124 156 5e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140898
SMART Domains Protein: ENSMUSP00000118771
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:ZnF_C3H1 45 71 3e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Donson A G 16: 91,681,219 Y465H probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Zc3h7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Zc3h7a APN 16 11137338 missense probably damaging 0.98
IGL00908:Zc3h7a APN 16 11145242 missense probably damaging 0.99
IGL01087:Zc3h7a APN 16 11153182 missense probably benign 0.28
IGL01285:Zc3h7a APN 16 11139115 missense probably damaging 1.00
IGL01453:Zc3h7a APN 16 11149378 missense probably benign 0.00
IGL01639:Zc3h7a APN 16 11141708 missense possibly damaging 0.75
IGL01716:Zc3h7a APN 16 11145716 missense probably damaging 1.00
IGL02059:Zc3h7a APN 16 11160998 unclassified probably benign
IGL02170:Zc3h7a APN 16 11146395 missense probably benign
IGL02256:Zc3h7a APN 16 11147276 missense probably benign 0.04
IGL02904:Zc3h7a APN 16 11150666 missense probably damaging 1.00
IGL02941:Zc3h7a APN 16 11158594 critical splice acceptor site probably null
IGL03198:Zc3h7a APN 16 11162664 nonsense probably null
IGL03201:Zc3h7a APN 16 11156302 critical splice acceptor site probably null
IGL03302:Zc3h7a APN 16 11141710 missense probably damaging 1.00
agreement UTSW 16 11153161 missense probably benign 0.02
Clement UTSW 16 11164602 nonsense probably null
consensus UTSW 16 11161026 missense probably damaging 1.00
R0062:Zc3h7a UTSW 16 11139147 missense probably damaging 1.00
R0255:Zc3h7a UTSW 16 11140737 missense probably damaging 1.00
R0376:Zc3h7a UTSW 16 11156202 missense probably benign 0.00
R0545:Zc3h7a UTSW 16 11152333 unclassified probably benign
R0666:Zc3h7a UTSW 16 11156303 unclassified probably benign
R0831:Zc3h7a UTSW 16 11151880 missense probably damaging 0.99
R1127:Zc3h7a UTSW 16 11139075 missense probably damaging 1.00
R1296:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1472:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1499:Zc3h7a UTSW 16 11162656 missense probably damaging 1.00
R1747:Zc3h7a UTSW 16 11145253 missense possibly damaging 0.67
R1786:Zc3h7a UTSW 16 11150605 nonsense probably null
R1840:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1866:Zc3h7a UTSW 16 11147304 missense possibly damaging 0.81
R2055:Zc3h7a UTSW 16 11137476 missense probably benign 0.00
R2131:Zc3h7a UTSW 16 11150605 nonsense probably null
R2281:Zc3h7a UTSW 16 11158594 unclassified probably benign
R2399:Zc3h7a UTSW 16 11147401 missense probably damaging 1.00
R2979:Zc3h7a UTSW 16 11158973 missense probably damaging 1.00
R3915:Zc3h7a UTSW 16 11156210 missense possibly damaging 0.92
R4078:Zc3h7a UTSW 16 11151147 missense probably benign 0.05
R4095:Zc3h7a UTSW 16 11145235 missense probably damaging 1.00
R4208:Zc3h7a UTSW 16 11164644 missense possibly damaging 0.60
R4444:Zc3h7a UTSW 16 11150593 critical splice donor site probably null
R4739:Zc3h7a UTSW 16 11141709 missense probably damaging 1.00
R5059:Zc3h7a UTSW 16 11161121 frame shift probably null
R5545:Zc3h7a UTSW 16 11148451 missense possibly damaging 0.89
R5815:Zc3h7a UTSW 16 11156186 missense probably damaging 0.98
R5915:Zc3h7a UTSW 16 11164602 nonsense probably null
R5993:Zc3h7a UTSW 16 11150662 missense probably damaging 1.00
R6183:Zc3h7a UTSW 16 11147370 missense possibly damaging 0.81
R6459:Zc3h7a UTSW 16 11153161 missense probably damaging 1.00
R6513:Zc3h7a UTSW 16 11158765 critical splice acceptor site probably null
R6700:Zc3h7a UTSW 16 11158967 missense possibly damaging 0.59
R6904:Zc3h7a UTSW 16 11145671 missense probably damaging 1.00
R7354:Zc3h7a UTSW 16 11148514 missense probably damaging 1.00
R7667:Zc3h7a UTSW 16 11139026 nonsense probably null
R7742:Zc3h7a UTSW 16 11153161 missense probably benign 0.02
R7780:Zc3h7a UTSW 16 11149251 missense probably benign 0.26
R8228:Zc3h7a UTSW 16 11139090 missense probably damaging 1.00
R8302:Zc3h7a UTSW 16 11137385 missense probably damaging 1.00
R8309:Zc3h7a UTSW 16 11146553 intron probably benign
R8795:Zc3h7a UTSW 16 11147283 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TATACACGCTGCTCTGCTTG -3'
(R):5'- GATGAATGCCGATATCCTGGCC -3'

Sequencing Primer
(F):5'- TTGTAGGCATGTACCACCAG -3'
(R):5'- GATATCCTGGCCACTGTACATTTG -3'
Posted On2018-11-28