Incidental Mutation 'R6964:Donson'
ID541912
Institutional Source Beutler Lab
Gene Symbol Donson
Ensembl Gene ENSMUSG00000022960
Gene Namedownstream neighbor of SON
SynonymsDonson, ORF60, 1110025J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6964 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location91676808-91688770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91681219 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 465 (Y465H)
Ref Sequence ENSEMBL: ENSMUSP00000121591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023682] [ENSMUST00000114031] [ENSMUST00000114037] [ENSMUST00000117159] [ENSMUST00000117633] [ENSMUST00000122302] [ENSMUST00000133942] [ENSMUST00000136699] [ENSMUST00000138560] [ENSMUST00000139324] [ENSMUST00000140312] [ENSMUST00000144461] [ENSMUST00000145833] [ENSMUST00000159295]
Predicted Effect probably benign
Transcript: ENSMUST00000023682
AA Change: Y495H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023682
Gene: ENSMUSG00000022960
AA Change: Y495H

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114031
SMART Domains Protein: ENSMUSP00000109665
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114037
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect silent
Transcript: ENSMUST00000117159
SMART Domains Protein: ENSMUSP00000113220
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117633
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133942
AA Change: Y283H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121386
Gene: ENSMUSG00000022960
AA Change: Y283H

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136699
Predicted Effect probably benign
Transcript: ENSMUST00000138560
AA Change: Y465H

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121591
Gene: ENSMUSG00000022960
AA Change: Y465H

DomainStartEndE-ValueType
low complexity region 31 52 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139324
SMART Domains Protein: ENSMUSP00000120957
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140312
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144461
SMART Domains Protein: ENSMUSP00000123648
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145833
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect
Meta Mutation Damage Score 0.3017 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene lies downstream of the SON gene and spans 10 kb on chromosome 21. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is early embryonic lethal. Heterozygous knockout causes no observable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,065,759 Y334* probably null Het
Abcc2 A C 19: 43,798,076 I116L probably benign Het
Adamts17 T A 7: 66,909,400 Y313N possibly damaging Het
Adamts17 A G 7: 67,004,353 T444A probably benign Het
Adamtsl1 A G 4: 86,156,854 I153V probably damaging Het
Ambra1 C T 2: 91,917,416 Q1046* probably null Het
Ap1g2 A T 14: 55,099,265 V750D possibly damaging Het
Bcl7a T C 5: 123,369,456 probably null Het
C4bp A T 1: 130,657,272 L9Q probably damaging Het
Cadps2 A C 6: 23,583,459 V344G probably damaging Het
Car7 A G 8: 104,543,581 D15G possibly damaging Het
Cep126 G C 9: 8,112,100 H157Q probably null Het
Chst11 C T 10: 83,191,381 T214I probably damaging Het
Cntrob G A 11: 69,309,491 R526* probably null Het
Cul1 A G 6: 47,516,509 T445A probably benign Het
Dclre1c T C 2: 3,453,169 V363A possibly damaging Het
Ddx58 A G 4: 40,225,697 S235P probably benign Het
Dock10 T A 1: 80,503,648 probably benign Het
Eif3e G A 15: 43,272,289 A118V probably benign Het
Fam47e A T 5: 92,566,052 Q180L probably damaging Het
Fat1 T G 8: 45,043,945 C4156G probably damaging Het
Fermt2 A T 14: 45,465,142 I441K probably damaging Het
Frmd4b C T 6: 97,305,197 R510Q probably damaging Het
Fscn1 C T 5: 142,960,660 A71V probably damaging Het
Gfap G A 11: 102,896,957 A54V possibly damaging Het
Gjc3 C T 5: 137,957,497 M175I probably benign Het
Gm10645 C T 8: 83,165,952 probably benign Het
Haus5 G A 7: 30,657,615 P464S probably benign Het
Helz2 T A 2: 181,230,428 I2584F probably damaging Het
Mak T A 13: 41,032,591 I534L probably benign Het
Map3k9 T C 12: 81,773,003 D159G probably benign Het
Mcat A G 15: 83,547,931 probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Ntng2 T A 2: 29,197,029 Y452F probably benign Het
Olfr1130 T C 2: 87,607,613 L75P probably damaging Het
Olfr1245 T A 2: 89,574,989 I246F probably benign Het
Olfr1474 T A 19: 13,471,361 Y130* probably null Het
Olfr473 A T 7: 107,933,759 I80L probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pianp T A 6: 124,999,390 V54D possibly damaging Het
Ptprn T C 1: 75,260,649 D103G possibly damaging Het
Rhcg A G 7: 79,600,531 V268A probably benign Het
Rhoj T A 12: 75,375,389 Y74N probably damaging Het
Snx13 A C 12: 35,119,789 T578P possibly damaging Het
Star T A 8: 25,811,823 H227Q probably benign Het
Stau2 A C 1: 16,390,005 M204R probably damaging Het
Steap4 A G 5: 7,975,568 Y43C probably damaging Het
Syt8 A G 7: 142,439,421 E21G probably benign Het
Tacr3 T C 3: 134,829,739 V156A probably damaging Het
Tmem106b C T 6: 13,082,423 T199M probably benign Het
Tmem131 T C 1: 36,796,292 T1583A probably damaging Het
Tom1 G A 8: 75,051,965 V87I probably null Het
Treml4 G T 17: 48,272,819 probably null Het
Ttn T C 2: 76,714,113 K32843R probably damaging Het
Wdr95 T G 5: 149,581,850 C223W probably damaging Het
Wipi1 C T 11: 109,603,764 R81Q probably benign Het
Zc3h7a G A 16: 11,149,224 T568I probably benign Het
Zfp287 A T 11: 62,724,817 I228N probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Other mutations in Donson
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Donson APN 16 91682591 missense possibly damaging 0.79
IGL02458:Donson APN 16 91681176 missense probably damaging 0.97
IGL03238:Donson APN 16 91681246 nonsense probably null
IGL02802:Donson UTSW 16 91681308 missense possibly damaging 0.66
R0525:Donson UTSW 16 91686245 missense probably damaging 1.00
R0831:Donson UTSW 16 91683763 missense probably damaging 1.00
R3706:Donson UTSW 16 91686161 unclassified probably benign
R4191:Donson UTSW 16 91688592 missense possibly damaging 0.81
R4746:Donson UTSW 16 91682237 missense probably damaging 1.00
R4788:Donson UTSW 16 91687833 missense possibly damaging 0.66
R4947:Donson UTSW 16 91682551 missense probably damaging 1.00
R5171:Donson UTSW 16 91681293 missense possibly damaging 0.93
R5439:Donson UTSW 16 91679926 missense probably damaging 0.99
R5739:Donson UTSW 16 91681229 splice site probably null
R5809:Donson UTSW 16 91687850 missense possibly damaging 0.69
R7022:Donson UTSW 16 91681330 missense probably damaging 1.00
R7110:Donson UTSW 16 91682121 nonsense probably null
R7326:Donson UTSW 16 91688711 start codon destroyed probably null 0.99
R7826:Donson UTSW 16 91688456 missense possibly damaging 0.90
Z1177:Donson UTSW 16 91688472 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGGGGTAAATCATGTTTCC -3'
(R):5'- TCGCATTCCCAGGAGTTTTGG -3'

Sequencing Primer
(F):5'- CTGGGGTAAATCATGTTTCCATAAAC -3'
(R):5'- GGTGACATGAGTTATATCAAATCCC -3'
Posted On2018-11-28