Incidental Mutation 'R6964:Or5b118'
ID 541915
Institutional Source Beutler Lab
Gene Symbol Or5b118
Ensembl Gene ENSMUSG00000096273
Gene Name olfactory receptor family 5 subfamily B member 118
Synonyms Olfr1474, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527, MOR202-42
MMRRC Submission 045074-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R6964 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 13448336-13449280 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 13448725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 130 (Y130*)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
AlphaFold Q7TQQ8
Predicted Effect probably null
Transcript: ENSMUST00000096202
AA Change: Y130*
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: Y130*

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207529
AA Change: Y88*
Predicted Effect probably null
Transcript: ENSMUST00000220113
AA Change: Y130*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 97,866,959 (GRCm39) Y334* probably null Het
Abcc2 A C 19: 43,786,515 (GRCm39) I116L probably benign Het
Adamts17 T A 7: 66,559,148 (GRCm39) Y313N possibly damaging Het
Adamts17 A G 7: 66,654,101 (GRCm39) T444A probably benign Het
Adamtsl1 A G 4: 86,075,091 (GRCm39) I153V probably damaging Het
Ambra1 C T 2: 91,747,761 (GRCm39) Q1046* probably null Het
Ap1g2 A T 14: 55,336,722 (GRCm39) V750D possibly damaging Het
Bcl7a T C 5: 123,507,519 (GRCm39) probably null Het
C4bp A T 1: 130,585,009 (GRCm39) L9Q probably damaging Het
Cadps2 A C 6: 23,583,458 (GRCm39) V344G probably damaging Het
Car7 A G 8: 105,270,213 (GRCm39) D15G possibly damaging Het
Cep126 G C 9: 8,112,101 (GRCm39) H157Q probably null Het
Chst11 C T 10: 83,027,215 (GRCm39) T214I probably damaging Het
Cntrob G A 11: 69,200,317 (GRCm39) R526* probably null Het
Cul1 A G 6: 47,493,443 (GRCm39) T445A probably benign Het
Dclre1c T C 2: 3,454,206 (GRCm39) V363A possibly damaging Het
Dock10 T A 1: 80,481,365 (GRCm39) probably benign Het
Donson A G 16: 91,478,107 (GRCm39) Y465H probably benign Het
Eif3e G A 15: 43,135,685 (GRCm39) A118V probably benign Het
Fam47e A T 5: 92,713,911 (GRCm39) Q180L probably damaging Het
Fat1 T G 8: 45,496,982 (GRCm39) C4156G probably damaging Het
Fermt2 A T 14: 45,702,599 (GRCm39) I441K probably damaging Het
Frmd4b C T 6: 97,282,158 (GRCm39) R510Q probably damaging Het
Fscn1 C T 5: 142,946,415 (GRCm39) A71V probably damaging Het
Gfap G A 11: 102,787,783 (GRCm39) A54V possibly damaging Het
Gjc3 C T 5: 137,955,759 (GRCm39) M175I probably benign Het
Gm10645 C T 8: 83,892,581 (GRCm39) probably benign Het
Haus5 G A 7: 30,357,040 (GRCm39) P464S probably benign Het
Helz2 T A 2: 180,872,221 (GRCm39) I2584F probably damaging Het
Mak T A 13: 41,186,067 (GRCm39) I534L probably benign Het
Map3k9 T C 12: 81,819,777 (GRCm39) D159G probably benign Het
Mcat A G 15: 83,432,132 (GRCm39) probably benign Het
Meltf A G 16: 31,698,980 (GRCm39) D30G probably benign Het
Ntng2 T A 2: 29,087,041 (GRCm39) Y452F probably benign Het
Or10ag60 T C 2: 87,437,957 (GRCm39) L75P probably damaging Het
Or4a72 T A 2: 89,405,333 (GRCm39) I246F probably benign Het
Or5p53 A T 7: 107,532,966 (GRCm39) I80L probably benign Het
Paip1 C T 13: 119,587,306 (GRCm39) T390I possibly damaging Het
Pianp T A 6: 124,976,353 (GRCm39) V54D possibly damaging Het
Ptprn T C 1: 75,237,293 (GRCm39) D103G possibly damaging Het
Rhcg A G 7: 79,250,279 (GRCm39) V268A probably benign Het
Rhoj T A 12: 75,422,163 (GRCm39) Y74N probably damaging Het
Rigi A G 4: 40,225,697 (GRCm39) S235P probably benign Het
Snx13 A C 12: 35,169,788 (GRCm39) T578P possibly damaging Het
Star T A 8: 26,301,851 (GRCm39) H227Q probably benign Het
Stau2 A C 1: 16,460,229 (GRCm39) M204R probably damaging Het
Steap4 A G 5: 8,025,568 (GRCm39) Y43C probably damaging Het
Syt8 A G 7: 141,993,158 (GRCm39) E21G probably benign Het
Tacr3 T C 3: 134,535,500 (GRCm39) V156A probably damaging Het
Tmem106b C T 6: 13,082,422 (GRCm39) T199M probably benign Het
Tmem131 T C 1: 36,835,373 (GRCm39) T1583A probably damaging Het
Tom1 G A 8: 75,778,593 (GRCm39) V87I probably null Het
Treml4 G T 17: 48,579,847 (GRCm39) probably null Het
Ttn T C 2: 76,544,457 (GRCm39) K32843R probably damaging Het
Wdr95 T G 5: 149,505,315 (GRCm39) C223W probably damaging Het
Wipi1 C T 11: 109,494,590 (GRCm39) R81Q probably benign Het
Zc3h7a G A 16: 10,967,088 (GRCm39) T568I probably benign Het
Zfp287 A T 11: 62,615,643 (GRCm39) I228N probably damaging Het
Zfp606 T A 7: 12,223,519 (GRCm39) V10E probably damaging Het
Other mutations in Or5b118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Or5b118 APN 19 13,448,631 (GRCm39) missense probably damaging 0.99
D605:Or5b118 UTSW 19 13,448,521 (GRCm39) nonsense probably null
R0173:Or5b118 UTSW 19 13,449,065 (GRCm39) missense probably benign 0.02
R1102:Or5b118 UTSW 19 13,448,771 (GRCm39) missense probably damaging 0.97
R1515:Or5b118 UTSW 19 13,449,044 (GRCm39) missense probably damaging 0.97
R1780:Or5b118 UTSW 19 13,448,726 (GRCm39) missense probably benign 0.14
R2061:Or5b118 UTSW 19 13,448,605 (GRCm39) missense probably damaging 0.98
R4016:Or5b118 UTSW 19 13,448,561 (GRCm39) missense possibly damaging 0.95
R4485:Or5b118 UTSW 19 13,448,919 (GRCm39) missense probably benign 0.08
R5119:Or5b118 UTSW 19 13,448,910 (GRCm39) missense probably benign 0.00
R5150:Or5b118 UTSW 19 13,448,794 (GRCm39) missense probably benign 0.01
R5156:Or5b118 UTSW 19 13,449,037 (GRCm39) missense probably damaging 1.00
R5699:Or5b118 UTSW 19 13,448,336 (GRCm39) start codon destroyed probably null 0.78
R5800:Or5b118 UTSW 19 13,449,260 (GRCm39) missense probably benign 0.06
R5840:Or5b118 UTSW 19 13,449,242 (GRCm39) missense probably benign 0.01
R5953:Or5b118 UTSW 19 13,448,732 (GRCm39) missense possibly damaging 0.92
R5997:Or5b118 UTSW 19 13,448,870 (GRCm39) missense probably benign 0.12
R6233:Or5b118 UTSW 19 13,449,104 (GRCm39) missense probably damaging 1.00
R6488:Or5b118 UTSW 19 13,448,981 (GRCm39) missense probably damaging 1.00
R6847:Or5b118 UTSW 19 13,448,402 (GRCm39) missense probably benign 0.03
R7214:Or5b118 UTSW 19 13,448,337 (GRCm39) start codon destroyed probably null 1.00
R8001:Or5b118 UTSW 19 13,448,786 (GRCm39) missense probably benign 0.03
R8035:Or5b118 UTSW 19 13,449,263 (GRCm39) missense probably benign
R8129:Or5b118 UTSW 19 13,448,508 (GRCm39) missense probably damaging 1.00
R9018:Or5b118 UTSW 19 13,448,721 (GRCm39) missense possibly damaging 0.60
R9061:Or5b118 UTSW 19 13,448,523 (GRCm39) missense probably damaging 0.98
R9065:Or5b118 UTSW 19 13,448,670 (GRCm39) missense probably damaging 0.97
R9373:Or5b118 UTSW 19 13,449,216 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTGTGTTTATGCCTCAGC -3'
(R):5'- TAGCCAAGACGAGCAGTGTAATC -3'

Sequencing Primer
(F):5'- TCAGCAATCACCCCCAAGG -3'
(R):5'- GACGAGCAGTGTAATCTCATTTG -3'
Posted On 2018-11-28