Incidental Mutation 'R6965:Csnk2a1-ps3'
ID 541923
Institutional Source Beutler Lab
Gene Symbol Csnk2a1-ps3
Ensembl Gene ENSMUSG00000101523
Gene Name casein kinase 2, alpha 1 polypeptide, pseudogene 3
Synonyms Gm10031, Csnk2a1-rs3, Csnk2a3
MMRRC Submission 045075-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.540) question?
Stock # R6965 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 156351663-156353140 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 156352119 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 107 (R107*)
Ref Sequence ENSEMBL: ENSMUSP00000140515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000190422]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000190422
AA Change: R107*
SMART Domains Protein: ENSMUSP00000140515
Gene: ENSMUSG00000101523
AA Change: R107*

DomainStartEndE-ValueType
S_TKc 39 324 1.88e-78 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 119,882,452 (GRCm39) Q1205* probably null Het
Als2 A G 1: 59,209,716 (GRCm39) F1422S possibly damaging Het
Anapc4 T C 5: 52,993,093 (GRCm39) V68A possibly damaging Het
Atmin T C 8: 117,683,777 (GRCm39) F479S probably damaging Het
Atp7b T C 8: 22,518,101 (GRCm39) T234A probably benign Het
Bpifa1 G A 2: 153,987,581 (GRCm39) G144S probably damaging Het
Brf2 A T 8: 27,614,586 (GRCm39) M200K probably benign Het
C1ql2 G A 1: 120,268,944 (GRCm39) C33Y probably damaging Het
Cdk18 A G 1: 132,045,319 (GRCm39) V269A probably damaging Het
Clcc1 T C 3: 108,580,625 (GRCm39) V313A probably damaging Het
Cntrl A T 2: 35,052,845 (GRCm39) T1117S probably benign Het
Col15a1 G A 4: 47,247,533 (GRCm39) E236K probably damaging Het
Comp T C 8: 70,829,164 (GRCm39) L278P probably damaging Het
Dlg5 C A 14: 24,199,498 (GRCm39) D1469Y probably damaging Het
Efna1 A T 3: 89,186,782 (GRCm39) V23D probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epb41l4b T C 4: 57,040,915 (GRCm39) Y516C probably damaging Het
Esr2 T C 12: 76,168,631 (GRCm39) D526G probably damaging Het
Fam184b T C 5: 45,712,477 (GRCm39) T514A probably benign Het
Fcmr A C 1: 130,803,724 (GRCm39) E176A possibly damaging Het
Fry T A 5: 150,339,685 (GRCm39) N1485K possibly damaging Het
Fut2 A G 7: 45,300,305 (GRCm39) C156R probably damaging Het
Gm5431 T C 11: 48,786,027 (GRCm39) Y116C probably benign Het
Gm5493 T A 17: 22,967,047 (GRCm39) V61E possibly damaging Het
Golga4 A T 9: 118,377,847 (GRCm39) Q456L probably damaging Het
Gpam T C 19: 55,063,041 (GRCm39) Y757C probably damaging Het
Iqcg C T 16: 32,851,174 (GRCm39) A266T probably benign Het
Lta4h G T 10: 93,307,759 (GRCm39) G331* probably null Het
Macf1 C A 4: 123,302,538 (GRCm39) V655F probably benign Het
Map3k13 T A 16: 21,740,900 (GRCm39) D742E probably benign Het
Mrgprb2 G A 7: 48,202,597 (GRCm39) L43F probably damaging Het
N4bp1 T C 8: 87,571,461 (GRCm39) R846G probably damaging Het
Nbn T C 4: 15,970,863 (GRCm39) I282T probably benign Het
Ncor1 C T 11: 62,244,059 (GRCm39) probably null Het
Or4a77 G T 2: 89,487,009 (GRCm39) P259T probably damaging Het
Or4d10c A G 19: 12,066,120 (GRCm39) F12S possibly damaging Het
Or8b12 T A 9: 37,657,433 (GRCm39) M1K probably null Het
Pclo A G 5: 14,731,976 (GRCm39) probably benign Het
Pde9a G T 17: 31,662,861 (GRCm39) V97L probably benign Het
Ptch1 T C 13: 63,672,881 (GRCm39) Y771C possibly damaging Het
R3hcc1l G A 19: 42,551,284 (GRCm39) D94N probably damaging Het
Rnpep T A 1: 135,190,858 (GRCm39) K602* probably null Het
Rph3al T C 11: 75,745,276 (GRCm39) Y156C probably damaging Het
Rundc1 A T 11: 101,324,737 (GRCm39) Y481F possibly damaging Het
Serpinb9f A G 13: 33,509,859 (GRCm39) K17R possibly damaging Het
Smpd3 T C 8: 106,986,513 (GRCm39) H459R probably damaging Het
Spata31 A C 13: 65,070,648 (GRCm39) Q932P possibly damaging Het
Srgap3 C T 6: 112,700,090 (GRCm39) A963T probably damaging Het
Syne1 A T 10: 5,179,120 (GRCm39) F4451L possibly damaging Het
Tbc1d19 T A 5: 54,014,266 (GRCm39) probably null Het
Thap12 T A 7: 98,364,669 (GRCm39) V279D probably damaging Het
Tmprss6 T C 15: 78,328,328 (GRCm39) D544G probably damaging Het
Tox2 A G 2: 163,164,930 (GRCm39) *523W probably null Het
Txnrd1 T C 10: 82,717,652 (GRCm39) I212T probably benign Het
Unc80 T C 1: 66,685,725 (GRCm39) I2283T probably benign Het
Vmn1r176 A G 7: 23,535,099 (GRCm39) I18T possibly damaging Het
Vmn2r101 C T 17: 19,811,284 (GRCm39) T456I probably benign Het
Vmn2r79 T A 7: 86,651,100 (GRCm39) H166Q probably benign Het
Zer1 A G 2: 29,991,059 (GRCm39) V723A possibly damaging Het
Other mutations in Csnk2a1-ps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03394:Csnk2a1-ps3 APN 1 156,352,792 (GRCm39) missense probably benign 0.34
R5578:Csnk2a1-ps3 UTSW 1 156,352,800 (GRCm39) missense probably benign
R6058:Csnk2a1-ps3 UTSW 1 156,352,425 (GRCm39) missense probably damaging 1.00
R6249:Csnk2a1-ps3 UTSW 1 156,352,800 (GRCm39) missense probably benign
R7514:Csnk2a1-ps3 UTSW 1 156,352,324 (GRCm39) missense probably benign 0.05
R7761:Csnk2a1-ps3 UTSW 1 156,352,707 (GRCm39) nonsense probably null
R7765:Csnk2a1-ps3 UTSW 1 156,352,354 (GRCm39) missense possibly damaging 0.47
R7782:Csnk2a1-ps3 UTSW 1 156,352,552 (GRCm39) missense probably damaging 1.00
R7889:Csnk2a1-ps3 UTSW 1 156,352,965 (GRCm39) missense probably benign
R7922:Csnk2a1-ps3 UTSW 1 156,352,562 (GRCm39) missense probably damaging 1.00
R8995:Csnk2a1-ps3 UTSW 1 156,352,873 (GRCm39) missense probably benign 0.00
R9095:Csnk2a1-ps3 UTSW 1 156,352,213 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAGCTTGTTCGAAAATTAGG -3'
(R):5'- CGAAGCTTTCTGTGCTCATG -3'

Sequencing Primer
(F):5'- CCAGCTTGTTCGAAAATTAGGTAGGG -3'
(R):5'- GAAGCTTTCTGTGCTCATGATCAATC -3'
Posted On 2018-11-28