Incidental Mutation 'R6965:Zer1'
ID541924
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Namezyg-11 related, cell cycle regulator
SynonymsC230075L19Rik, Zyg11bl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6965 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location30097283-30124585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30101047 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 723 (V723A)
Ref Sequence ENSEMBL: ENSMUSP00000046441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044751
AA Change: V723A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: V723A

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000113677
AA Change: V710A

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: V710A

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,283,229 Q1205* probably null Het
Als2 A G 1: 59,170,557 F1422S possibly damaging Het
Anapc4 T C 5: 52,835,751 V68A possibly damaging Het
Atmin T C 8: 116,957,038 F479S probably damaging Het
Atp7b T C 8: 22,028,085 T234A probably benign Het
Bpifa1 G A 2: 154,145,661 G144S probably damaging Het
Brf2 A T 8: 27,124,558 M200K probably benign Het
C1ql2 G A 1: 120,341,215 C33Y probably damaging Het
Cdk18 A G 1: 132,117,581 V269A probably damaging Het
Clcc1 T C 3: 108,673,309 V313A probably damaging Het
Cntrl A T 2: 35,162,833 T1117S probably benign Het
Col15a1 G A 4: 47,247,533 E236K probably damaging Het
Comp T C 8: 70,376,514 L278P probably damaging Het
Dlg5 C A 14: 24,149,430 D1469Y probably damaging Het
Efna1 A T 3: 89,279,475 V23D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epb41l4b T C 4: 57,040,915 Y516C probably damaging Het
Esr2 T C 12: 76,121,857 D526G probably damaging Het
Fam184b T C 5: 45,555,135 T514A probably benign Het
Fcmr A C 1: 130,875,987 E176A possibly damaging Het
Fry T A 5: 150,416,220 N1485K possibly damaging Het
Fut2 A G 7: 45,650,881 C156R probably damaging Het
Gm10031 C T 1: 156,524,549 R107* probably null Het
Gm5431 T C 11: 48,895,200 Y116C probably benign Het
Gm5493 T A 17: 22,748,074 V61E possibly damaging Het
Golga4 A T 9: 118,548,779 Q456L probably damaging Het
Gpam T C 19: 55,074,609 Y757C probably damaging Het
Iqcg C T 16: 33,030,804 A266T probably benign Het
Lta4h G T 10: 93,471,897 G331* probably null Het
Macf1 C A 4: 123,408,745 V655F probably benign Het
Map3k13 T A 16: 21,922,150 D742E probably benign Het
Mrgprb2 G A 7: 48,552,849 L43F probably damaging Het
N4bp1 T C 8: 86,844,833 R846G probably damaging Het
Nbn T C 4: 15,970,863 I282T probably benign Het
Ncor1 C T 11: 62,353,233 probably null Het
Olfr1250 G T 2: 89,656,665 P259T probably damaging Het
Olfr1426 A G 19: 12,088,756 F12S possibly damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Pclo A G 5: 14,681,962 probably benign Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Ptch1 T C 13: 63,525,067 Y771C possibly damaging Het
R3hcc1l G A 19: 42,562,845 D94N probably damaging Het
Rnpep T A 1: 135,263,120 K602* probably null Het
Rph3al T C 11: 75,854,450 Y156C probably damaging Het
Rundc1 A T 11: 101,433,911 Y481F possibly damaging Het
Serpinb9f A G 13: 33,325,876 K17R possibly damaging Het
Smpd3 T C 8: 106,259,881 H459R probably damaging Het
Spata31 A C 13: 64,922,834 Q932P possibly damaging Het
Srgap3 C T 6: 112,723,129 A963T probably damaging Het
Syne1 A T 10: 5,229,120 F4451L possibly damaging Het
Tbc1d19 T A 5: 53,856,924 probably null Het
Thap12 T A 7: 98,715,462 V279D probably damaging Het
Tmprss6 T C 15: 78,444,128 D544G probably damaging Het
Tox2 A G 2: 163,323,010 *523W probably null Het
Txnrd1 T C 10: 82,881,818 I212T probably benign Het
Unc80 T C 1: 66,646,566 I2283T probably benign Het
Vmn1r176 A G 7: 23,835,674 I18T possibly damaging Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Vmn2r79 T A 7: 87,001,892 H166Q probably benign Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 30108220 critical splice donor site probably null
IGL01630:Zer1 APN 2 30101831 missense probably damaging 1.00
IGL02126:Zer1 APN 2 30104916 missense probably benign 0.10
IGL02338:Zer1 APN 2 30113393 missense probably damaging 1.00
IGL02817:Zer1 APN 2 30103394 missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 30101120 missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 30103543 missense probably benign 0.01
R0390:Zer1 UTSW 2 30108213 splice site probably benign
R0506:Zer1 UTSW 2 30101807 missense probably damaging 1.00
R0606:Zer1 UTSW 2 30104797 splice site probably benign
R0928:Zer1 UTSW 2 30101763 critical splice donor site probably null
R1167:Zer1 UTSW 2 30108246 missense probably benign 0.00
R1819:Zer1 UTSW 2 30110218 missense probably benign 0.18
R2040:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2041:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2042:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2092:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2168:Zer1 UTSW 2 30104875 missense probably damaging 1.00
R2243:Zer1 UTSW 2 30101127 missense probably damaging 0.99
R2254:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2255:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2311:Zer1 UTSW 2 30101822 missense probably damaging 0.99
R2993:Zer1 UTSW 2 30101897 missense probably damaging 1.00
R3010:Zer1 UTSW 2 30113285 missense probably benign 0.13
R3731:Zer1 UTSW 2 30110911 missense probably benign 0.44
R4038:Zer1 UTSW 2 30107523 missense probably damaging 1.00
R5241:Zer1 UTSW 2 30104970 missense probably damaging 1.00
R5433:Zer1 UTSW 2 30100986 intron probably benign
R5443:Zer1 UTSW 2 30110996 missense probably damaging 1.00
R5524:Zer1 UTSW 2 30104854 missense probably damaging 1.00
R5936:Zer1 UTSW 2 30107667 missense probably damaging 0.97
R5999:Zer1 UTSW 2 30104997 missense probably damaging 1.00
R6598:Zer1 UTSW 2 30113274 missense probably damaging 1.00
R7030:Zer1 UTSW 2 30111021 missense probably benign 0.00
R7190:Zer1 UTSW 2 30103432 missense probably damaging 1.00
R7218:Zer1 UTSW 2 30105012 missense probably damaging 1.00
R7252:Zer1 UTSW 2 30101892 missense probably damaging 0.99
R7383:Zer1 UTSW 2 30111241 missense probably damaging 1.00
R7417:Zer1 UTSW 2 30102822 missense probably damaging 1.00
R7459:Zer1 UTSW 2 30113325 missense probably damaging 1.00
R7463:Zer1 UTSW 2 30113437 start gained probably benign
R7477:Zer1 UTSW 2 30107976 missense probably null 0.34
R7719:Zer1 UTSW 2 30111231 missense probably damaging 1.00
X0026:Zer1 UTSW 2 30104895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTTCACTGGCAGGTAGGG -3'
(R):5'- TTCTCCAGAGCGAGCTTCTG -3'

Sequencing Primer
(F):5'- CTGGCAGGTAGGGGAAGAGTG -3'
(R):5'- TGGCATCCTACAGGCTTGC -3'
Posted On2018-11-28