Mutagenetix > Incidental Mutations

Incidental Mutation 'R6965:Cntrl'

541925

Institutional Source

Beutler Lab

Gene Symbol

Cntrl

Ensembl Gene

ENSMUSG00000057110

Gene Name

centriolin

Synonyms

6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R6965 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

35109492-35178822 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35162833 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1117 (T1117S)

Ref Sequence

ENSEMBL: ENSMUSP00000108660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000124081] [ENSMUST00000156933]

Predicted Effect

probably benign
Transcript: ENSMUST00000028237
AA Change: T1671S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: T1671S

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
LRR	146	167	2.54e1	SMART
LRR	168	190	3.24e0	SMART
LRR	192	214	7.16e0	SMART
Blast:LRR	217	239	8e-6	BLAST
low complexity region	275	292	N/A	INTRINSIC
coiled coil region	437	800	N/A	INTRINSIC
coiled coil region	858	971	N/A	INTRINSIC
low complexity region	975	995	N/A	INTRINSIC
coiled coil region	998	1102	N/A	INTRINSIC
internal_repeat_1	1119	1132	1.95e-5	PROSPERO
low complexity region	1153	1161	N/A	INTRINSIC
low complexity region	1268	1301	N/A	INTRINSIC
coiled coil region	1320	1629	N/A	INTRINSIC
coiled coil region	1661	2155	N/A	INTRINSIC
low complexity region	2193	2208	N/A	INTRINSIC
internal_repeat_1	2252	2265	1.95e-5	PROSPERO
low complexity region	2289	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113032
AA Change: T1670S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: T1670S

Domain	Start	End	E-Value	Type
low complexity region	20	53	N/A	INTRINSIC
coiled coil region	72	381	N/A	INTRINSIC
coiled coil region	413	907	N/A	INTRINSIC
low complexity region	945	960	N/A	INTRINSIC
coiled coil region	989	1011	N/A	INTRINSIC
low complexity region	1041	1059	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113034

SMART Domains

Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110

Domain	Start	End	E-Value	Type
coiled coil region	1	247	N/A	INTRINSIC
internal_repeat_3	261	278	5.68e-5	PROSPERO
coiled coil region	305	418	N/A	INTRINSIC
low complexity region	422	442	N/A	INTRINSIC
coiled coil region	445	549	N/A	INTRINSIC
internal_repeat_1	566	579	1.52e-6	PROSPERO
internal_repeat_2	568	596	2.75e-5	PROSPERO
low complexity region	600	608	N/A	INTRINSIC
internal_repeat_2	626	653	2.75e-5	PROSPERO
low complexity region	715	748	N/A	INTRINSIC
coiled coil region	767	1076	N/A	INTRINSIC
internal_repeat_3	1095	1112	5.68e-5	PROSPERO
low complexity region	1184	1224	N/A	INTRINSIC
low complexity region	1344	1356	N/A	INTRINSIC
low complexity region	1366	1388	N/A	INTRINSIC
low complexity region	1400	1415	N/A	INTRINSIC
low complexity region	1421	1432	N/A	INTRINSIC
low complexity region	1640	1655	N/A	INTRINSIC
internal_repeat_1	1699	1712	1.52e-6	PROSPERO
low complexity region	1736	1754	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113037
AA Change: T1117S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110
AA Change: T1117S

Domain	Start	End	E-Value	Type
coiled coil region	1	247	N/A	INTRINSIC
internal_repeat_3	261	278	5.34e-5	PROSPERO
coiled coil region	305	548	N/A	INTRINSIC
internal_repeat_1	565	578	1.42e-6	PROSPERO
internal_repeat_2	567	595	2.58e-5	PROSPERO
low complexity region	599	607	N/A	INTRINSIC
internal_repeat_2	625	652	2.58e-5	PROSPERO
low complexity region	714	747	N/A	INTRINSIC
coiled coil region	766	1075	N/A	INTRINSIC
internal_repeat_3	1094	1111	5.34e-5	PROSPERO
low complexity region	1183	1223	N/A	INTRINSIC
low complexity region	1343	1355	N/A	INTRINSIC
low complexity region	1365	1387	N/A	INTRINSIC
low complexity region	1399	1414	N/A	INTRINSIC
low complexity region	1420	1431	N/A	INTRINSIC
low complexity region	1639	1654	N/A	INTRINSIC
internal_repeat_1	1698	1711	1.42e-6	PROSPERO
low complexity region	1735	1753	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124081

SMART Domains

Protein: ENSMUSP00000143087
Gene: ENSMUSG00000057110

Domain	Start	End	E-Value	Type
coiled coil region	1	51	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156933
AA Change: T1671S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: T1671S

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
LRR	146	167	2.54e1	SMART
LRR	168	190	3.24e0	SMART
LRR	192	214	7.16e0	SMART
Blast:LRR	217	239	7e-6	BLAST
low complexity region	275	292	N/A	INTRINSIC
coiled coil region	437	800	N/A	INTRINSIC
coiled coil region	858	971	N/A	INTRINSIC
low complexity region	975	995	N/A	INTRINSIC
coiled coil region	998	1102	N/A	INTRINSIC
internal_repeat_1	1119	1132	1.65e-5	PROSPERO
low complexity region	1153	1161	N/A	INTRINSIC
low complexity region	1268	1301	N/A	INTRINSIC
coiled coil region	1320	1629	N/A	INTRINSIC
coiled coil region	1661	2155	N/A	INTRINSIC
low complexity region	2193	2208	N/A	INTRINSIC
internal_repeat_1	2252	2265	1.65e-5	PROSPERO
low complexity region	2289	2307	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	C	T	7: 120,283,229	Q1205*	probably null	Het
Als2	A	G	1: 59,170,557	F1422S	possibly damaging	Het
Anapc4	T	C	5: 52,835,751	V68A	possibly damaging	Het
Atmin	T	C	8: 116,957,038	F479S	probably damaging	Het
Atp7b	T	C	8: 22,028,085	T234A	probably benign	Het
Bpifa1	G	A	2: 154,145,661	G144S	probably damaging	Het
Brf2	A	T	8: 27,124,558	M200K	probably benign	Het
C1ql2	G	A	1: 120,341,215	C33Y	probably damaging	Het
Cdk18	A	G	1: 132,117,581	V269A	probably damaging	Het
Clcc1	T	C	3: 108,673,309	V313A	probably damaging	Het
Col15a1	G	A	4: 47,247,533	E236K	probably damaging	Het
Comp	T	C	8: 70,376,514	L278P	probably damaging	Het
Dlg5	C	A	14: 24,149,430	D1469Y	probably damaging	Het
Efna1	A	T	3: 89,279,475	V23D	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epb41l4b	T	C	4: 57,040,915	Y516C	probably damaging	Het
Esr2	T	C	12: 76,121,857	D526G	probably damaging	Het
Fam184b	T	C	5: 45,555,135	T514A	probably benign	Het
Fcmr	A	C	1: 130,875,987	E176A	possibly damaging	Het
Fry	T	A	5: 150,416,220	N1485K	possibly damaging	Het
Fut2	A	G	7: 45,650,881	C156R	probably damaging	Het
Gm10031	C	T	1: 156,524,549	R107*	probably null	Het
Gm5431	T	C	11: 48,895,200	Y116C	probably benign	Het
Gm5493	T	A	17: 22,748,074	V61E	possibly damaging	Het
Golga4	A	T	9: 118,548,779	Q456L	probably damaging	Het
Gpam	T	C	19: 55,074,609	Y757C	probably damaging	Het
Iqcg	C	T	16: 33,030,804	A266T	probably benign	Het
Lta4h	G	T	10: 93,471,897	G331*	probably null	Het
Macf1	C	A	4: 123,408,745	V655F	probably benign	Het
Map3k13	T	A	16: 21,922,150	D742E	probably benign	Het
Mrgprb2	G	A	7: 48,552,849	L43F	probably damaging	Het
N4bp1	T	C	8: 86,844,833	R846G	probably damaging	Het
Nbn	T	C	4: 15,970,863	I282T	probably benign	Het
Ncor1	C	T	11: 62,353,233		probably null	Het
Olfr1250	G	T	2: 89,656,665	P259T	probably damaging	Het
Olfr1426	A	G	19: 12,088,756	F12S	possibly damaging	Het
Olfr874	T	A	9: 37,746,137	M1K	probably null	Het
Pclo	A	G	5: 14,681,962		probably benign	Het
Pde9a	G	T	17: 31,443,887	V97L	probably benign	Het
Ptch1	T	C	13: 63,525,067	Y771C	possibly damaging	Het
R3hcc1l	G	A	19: 42,562,845	D94N	probably damaging	Het
Rnpep	T	A	1: 135,263,120	K602*	probably null	Het
Rph3al	T	C	11: 75,854,450	Y156C	probably damaging	Het
Rundc1	A	T	11: 101,433,911	Y481F	possibly damaging	Het
Serpinb9f	A	G	13: 33,325,876	K17R	possibly damaging	Het
Smpd3	T	C	8: 106,259,881	H459R	probably damaging	Het
Spata31	A	C	13: 64,922,834	Q932P	possibly damaging	Het
Srgap3	C	T	6: 112,723,129	A963T	probably damaging	Het
Syne1	A	T	10: 5,229,120	F4451L	possibly damaging	Het
Tbc1d19	T	A	5: 53,856,924		probably null	Het
Thap12	T	A	7: 98,715,462	V279D	probably damaging	Het
Tmprss6	T	C	15: 78,444,128	D544G	probably damaging	Het
Tox2	A	G	2: 163,323,010	*523W	probably null	Het
Txnrd1	T	C	10: 82,881,818	I212T	probably benign	Het
Unc80	T	C	1: 66,646,566	I2283T	probably benign	Het
Vmn1r176	A	G	7: 23,835,674	I18T	possibly damaging	Het
Vmn2r101	C	T	17: 19,591,022	T456I	probably benign	Het
Vmn2r79	T	A	7: 87,001,892	H166Q	probably benign	Het
Zer1	A	G	2: 30,101,047	V723A	possibly damaging	Het

Other mutations in Cntrl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cntrl	APN	2	35137814	splice site	probably benign
IGL00478:Cntrl	APN	2	35160601	missense	probably damaging	0.98
IGL01460:Cntrl	APN	2	35165844	missense	probably benign	0.04
IGL01556:Cntrl	APN	2	35173059	missense	probably benign	0.19
IGL02155:Cntrl	APN	2	35160238	splice site	probably benign
IGL02419:Cntrl	APN	2	35134043	missense	probably damaging	0.97
PIT4480001:Cntrl	UTSW	2	35155428	missense	probably damaging	0.96
R0179:Cntrl	UTSW	2	35167859	missense	probably benign	0.00
R0276:Cntrl	UTSW	2	35151732	missense	possibly damaging	0.62
R0471:Cntrl	UTSW	2	35127380	missense	probably benign	0.41
R0755:Cntrl	UTSW	2	35145139	missense	probably damaging	1.00
R0763:Cntrl	UTSW	2	35171066	missense	probably benign
R0781:Cntrl	UTSW	2	35160627	missense	possibly damaging	0.66
R0791:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R0792:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R0801:Cntrl	UTSW	2	35175095	splice site	probably benign
R1067:Cntrl	UTSW	2	35149022	unclassified	probably benign
R1110:Cntrl	UTSW	2	35160627	missense	possibly damaging	0.66
R1117:Cntrl	UTSW	2	35127973	missense	probably damaging	1.00
R1457:Cntrl	UTSW	2	35122756	missense	probably benign	0.00
R1472:Cntrl	UTSW	2	35169317	critical splice donor site	probably null
R1522:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R1702:Cntrl	UTSW	2	35171836	critical splice acceptor site	probably null
R1762:Cntrl	UTSW	2	35122806	frame shift	probably null
R1785:Cntrl	UTSW	2	35122806	frame shift	probably null
R1786:Cntrl	UTSW	2	35122806	frame shift	probably null
R1812:Cntrl	UTSW	2	35149469	missense	probably damaging	0.97
R1854:Cntrl	UTSW	2	35122684	missense	probably damaging	1.00
R1863:Cntrl	UTSW	2	35118119	missense	possibly damaging	0.93
R1868:Cntrl	UTSW	2	35129815	missense	probably benign	0.03
R1914:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R1915:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R2049:Cntrl	UTSW	2	35122806	frame shift	probably null
R2118:Cntrl	UTSW	2	35161965	missense	probably benign	0.31
R2140:Cntrl	UTSW	2	35122806	frame shift	probably null
R2142:Cntrl	UTSW	2	35122806	frame shift	probably null
R2203:Cntrl	UTSW	2	35143737	missense	possibly damaging	0.84
R2300:Cntrl	UTSW	2	35127513	missense	probably benign	0.00
R2349:Cntrl	UTSW	2	35176251	missense	probably benign	0.18
R2374:Cntrl	UTSW	2	35153276	missense	possibly damaging	0.46
R3429:Cntrl	UTSW	2	35145100	missense	probably damaging	1.00
R3890:Cntrl	UTSW	2	35170480	missense	probably benign	0.02
R3911:Cntrl	UTSW	2	35120049	missense	probably damaging	1.00
R3922:Cntrl	UTSW	2	35129739	missense	probably damaging	0.98
R4081:Cntrl	UTSW	2	35161926	splice site	probably benign
R4081:Cntrl	UTSW	2	35175125	missense	probably damaging	1.00
R4516:Cntrl	UTSW	2	35127981	missense	probably benign	0.00
R4518:Cntrl	UTSW	2	35148974	missense	probably damaging	1.00
R4519:Cntrl	UTSW	2	35173111	missense	probably damaging	1.00
R4646:Cntrl	UTSW	2	35149461	missense	probably damaging	0.99
R4753:Cntrl	UTSW	2	35153439	missense	possibly damaging	0.90
R4763:Cntrl	UTSW	2	35175551	missense	probably damaging	1.00
R4916:Cntrl	UTSW	2	35165682	missense	probably benign	0.42
R5168:Cntrl	UTSW	2	35157655	missense	probably damaging	1.00
R5291:Cntrl	UTSW	2	35134060	missense	probably damaging	1.00
R5356:Cntrl	UTSW	2	35148899	nonsense	probably null
R5774:Cntrl	UTSW	2	35162861	missense	probably benign	0.15
R5947:Cntrl	UTSW	2	35116679	missense	probably damaging	1.00
R6144:Cntrl	UTSW	2	35165733	missense	possibly damaging	0.93
R6147:Cntrl	UTSW	2	35165733	missense	possibly damaging	0.93
R6214:Cntrl	UTSW	2	35129634	missense	probably benign	0.10
R6267:Cntrl	UTSW	2	35129793	missense	probably damaging	1.00
R6332:Cntrl	UTSW	2	35128024	missense	possibly damaging	0.78
R6445:Cntrl	UTSW	2	35162848	missense	probably benign	0.05
R6487:Cntrl	UTSW	2	35122682	missense	possibly damaging	0.89
R6497:Cntrl	UTSW	2	35135572	missense	possibly damaging	0.66
R6782:Cntrl	UTSW	2	35170646	missense	possibly damaging	0.75
R6815:Cntrl	UTSW	2	35149491	missense	probably damaging	1.00
R6853:Cntrl	UTSW	2	35129821	missense	possibly damaging	0.87
R6858:Cntrl	UTSW	2	35162095	critical splice donor site	probably null
R6970:Cntrl	UTSW	2	35118137	missense	probably benign
R7085:Cntrl	UTSW	2	35165792	missense	probably benign	0.00
R7150:Cntrl	UTSW	2	35165445	critical splice acceptor site	probably null
R7213:Cntrl	UTSW	2	35135680	missense	possibly damaging	0.95
R7221:Cntrl	UTSW	2	35151857	missense	possibly damaging	0.46
R7389:Cntrl	UTSW	2	35127517	missense	probably benign	0.01
R7414:Cntrl	UTSW	2	35165467	missense	probably benign	0.02
R7427:Cntrl	UTSW	2	35170534	missense	probably benign	0.00
R7428:Cntrl	UTSW	2	35170534	missense	probably benign	0.00
R7453:Cntrl	UTSW	2	35155409	missense	possibly damaging	0.89
R7747:Cntrl	UTSW	2	35116798	missense	probably damaging	1.00
R7753:Cntrl	UTSW	2	35111679	missense	probably damaging	1.00
R7811:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R7882:Cntrl	UTSW	2	35170580	missense	probably benign	0.41
R7919:Cntrl	UTSW	2	35127401	missense	probably benign
R8314:Cntrl	UTSW	2	35175143	missense	probably benign	0.00
R8332:Cntrl	UTSW	2	35126025	missense	probably damaging	1.00
RF007:Cntrl	UTSW	2	35170500	missense	probably benign
RF016:Cntrl	UTSW	2	35119986	missense	probably benign
RF017:Cntrl	UTSW	2	35175189	missense	probably damaging	0.96
X0024:Cntrl	UTSW	2	35147296	missense	probably damaging	1.00
X0026:Cntrl	UTSW	2	35149516	missense	probably damaging	1.00
X0027:Cntrl	UTSW	2	35157768	missense	probably damaging	1.00
X0027:Cntrl	UTSW	2	35165682	missense	probably benign	0.08
X0028:Cntrl	UTSW	2	35147344	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CACTGTTCTTGTACCAAAGGC -3'
(R):5'- TTCAGAGGTGAACTTGGCC -3'

Sequencing Primer
(F):5'- GACTGGTGTAAAGGGGATT -3'
(R):5'- AACTTGGCCAGGTGCACTTC -3'

Posted On

2018-11-28