Incidental Mutation 'R6965:Tox2'
ID541928
Institutional Source Beutler Lab
Gene Symbol Tox2
Ensembl Gene ENSMUSG00000074607
Gene NameTOX high mobility group box family member 2
SynonymsLOC269389, RxHMG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6965 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location163203125-163324170 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 163323010 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 523 (*523W)
Ref Sequence ENSEMBL: ENSMUSP00000126243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099110] [ENSMUST00000109428] [ENSMUST00000165937]
Predicted Effect probably benign
Transcript: ENSMUST00000099110
SMART Domains Protein: ENSMUSP00000096710
Gene: ENSMUSG00000074607

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
HMG 287 357 1.44e-18 SMART
low complexity region 424 451 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109428
SMART Domains Protein: ENSMUSP00000105055
Gene: ENSMUSG00000074607

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
HMG 245 315 1.44e-18 SMART
low complexity region 382 409 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
low complexity region 457 482 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148599
AA Change: *169W
SMART Domains Protein: ENSMUSP00000118219
Gene: ENSMUSG00000074607
AA Change: *169W

DomainStartEndE-ValueType
low complexity region 36 63 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165937
AA Change: *523W
SMART Domains Protein: ENSMUSP00000126243
Gene: ENSMUSG00000074607
AA Change: *523W

DomainStartEndE-ValueType
low complexity region 75 87 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
HMG 252 322 1.44e-18 SMART
low complexity region 389 416 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,283,229 Q1205* probably null Het
Als2 A G 1: 59,170,557 F1422S possibly damaging Het
Anapc4 T C 5: 52,835,751 V68A possibly damaging Het
Atmin T C 8: 116,957,038 F479S probably damaging Het
Atp7b T C 8: 22,028,085 T234A probably benign Het
Bpifa1 G A 2: 154,145,661 G144S probably damaging Het
Brf2 A T 8: 27,124,558 M200K probably benign Het
C1ql2 G A 1: 120,341,215 C33Y probably damaging Het
Cdk18 A G 1: 132,117,581 V269A probably damaging Het
Clcc1 T C 3: 108,673,309 V313A probably damaging Het
Cntrl A T 2: 35,162,833 T1117S probably benign Het
Col15a1 G A 4: 47,247,533 E236K probably damaging Het
Comp T C 8: 70,376,514 L278P probably damaging Het
Dlg5 C A 14: 24,149,430 D1469Y probably damaging Het
Efna1 A T 3: 89,279,475 V23D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epb41l4b T C 4: 57,040,915 Y516C probably damaging Het
Esr2 T C 12: 76,121,857 D526G probably damaging Het
Fam184b T C 5: 45,555,135 T514A probably benign Het
Fcmr A C 1: 130,875,987 E176A possibly damaging Het
Fry T A 5: 150,416,220 N1485K possibly damaging Het
Fut2 A G 7: 45,650,881 C156R probably damaging Het
Gm10031 C T 1: 156,524,549 R107* probably null Het
Gm5431 T C 11: 48,895,200 Y116C probably benign Het
Gm5493 T A 17: 22,748,074 V61E possibly damaging Het
Golga4 A T 9: 118,548,779 Q456L probably damaging Het
Gpam T C 19: 55,074,609 Y757C probably damaging Het
Iqcg C T 16: 33,030,804 A266T probably benign Het
Lta4h G T 10: 93,471,897 G331* probably null Het
Macf1 C A 4: 123,408,745 V655F probably benign Het
Map3k13 T A 16: 21,922,150 D742E probably benign Het
Mrgprb2 G A 7: 48,552,849 L43F probably damaging Het
N4bp1 T C 8: 86,844,833 R846G probably damaging Het
Nbn T C 4: 15,970,863 I282T probably benign Het
Ncor1 C T 11: 62,353,233 probably null Het
Olfr1250 G T 2: 89,656,665 P259T probably damaging Het
Olfr1426 A G 19: 12,088,756 F12S possibly damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Pclo A G 5: 14,681,962 probably benign Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Ptch1 T C 13: 63,525,067 Y771C possibly damaging Het
R3hcc1l G A 19: 42,562,845 D94N probably damaging Het
Rnpep T A 1: 135,263,120 K602* probably null Het
Rph3al T C 11: 75,854,450 Y156C probably damaging Het
Rundc1 A T 11: 101,433,911 Y481F possibly damaging Het
Serpinb9f A G 13: 33,325,876 K17R possibly damaging Het
Smpd3 T C 8: 106,259,881 H459R probably damaging Het
Spata31 A C 13: 64,922,834 Q932P possibly damaging Het
Srgap3 C T 6: 112,723,129 A963T probably damaging Het
Syne1 A T 10: 5,229,120 F4451L possibly damaging Het
Tbc1d19 T A 5: 53,856,924 probably null Het
Thap12 T A 7: 98,715,462 V279D probably damaging Het
Tmprss6 T C 15: 78,444,128 D544G probably damaging Het
Txnrd1 T C 10: 82,881,818 I212T probably benign Het
Unc80 T C 1: 66,646,566 I2283T probably benign Het
Vmn1r176 A G 7: 23,835,674 I18T possibly damaging Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Vmn2r79 T A 7: 87,001,892 H166Q probably benign Het
Zer1 A G 2: 30,101,047 V723A possibly damaging Het
Other mutations in Tox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Tox2 APN 2 163225466 utr 5 prime probably benign
IGL01891:Tox2 APN 2 163322983 missense possibly damaging 0.48
IGL02190:Tox2 APN 2 163323006 missense possibly damaging 0.91
IGL02576:Tox2 APN 2 163276180 missense probably damaging 0.99
R0881:Tox2 UTSW 2 163321445 missense probably benign 0.18
R1739:Tox2 UTSW 2 163247785 missense probably damaging 0.99
R1742:Tox2 UTSW 2 163225526 missense probably benign 0.04
R1900:Tox2 UTSW 2 163276167 missense probably damaging 1.00
R1937:Tox2 UTSW 2 163225556 missense probably benign
R2345:Tox2 UTSW 2 163319598 missense probably damaging 1.00
R2842:Tox2 UTSW 2 163204630 intron probably benign
R3753:Tox2 UTSW 2 163314323 missense probably damaging 1.00
R4614:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4615:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4616:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4618:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4625:Tox2 UTSW 2 163314416 missense possibly damaging 0.71
R5410:Tox2 UTSW 2 163320373 missense probably benign 0.04
R5493:Tox2 UTSW 2 163204729 nonsense probably null
R6731:Tox2 UTSW 2 163320377 missense probably damaging 1.00
R7038:Tox2 UTSW 2 163314344 missense probably damaging 0.99
R7078:Tox2 UTSW 2 163320581 missense
R7422:Tox2 UTSW 2 163321515 missense
R7577:Tox2 UTSW 2 163315902 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATAAATCGCTCTACCTCACC -3'
(R):5'- GTACACTGAGAGCACACCTG -3'

Sequencing Primer
(F):5'- GATAAATCGCTCTACCTCACCTAATC -3'
(R):5'- TGAGAGCACACCTGTGGCTG -3'
Posted On2018-11-28